View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19753_low_9 (Length: 281)
Name: NF19753_low_9
Description: NF19753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19753_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 237
Target Start/End: Original strand, 54702160 - 54702378
Alignment:
| Q |
19 |
tttcccctatgaatgagtcagtggttagaactaacaaaatagttgccaagttgatacattaatatggtcatggcagacaagttcataaactgaactctgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54702160 |
tttcccctatgaatgagtcagtggttagaactaacaaaatagttgccaagttgatacattaatatggtcatggcagacaagttcataaactgaactctgt |
54702259 |
T |
 |
| Q |
119 |
ttaataattgaaacagctcctcatccagaaaatatcttccattatcgataatctacaggattggaaaattgatgattaaggtttaagaaggataggtgca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54702260 |
ttaataattgaaacagctcctcatccagaaaatatcttccattatcgataatctacaggattggaaaattgatgattaaggtttaagaaggataggtgca |
54702359 |
T |
 |
| Q |
219 |
tcgaaagcgttgcaaggca |
237 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
54702360 |
tcgaaagcgttgcaaggca |
54702378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University