View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19755_high_27 (Length: 403)
Name: NF19755_high_27
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19755_high_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 20 - 399
Target Start/End: Original strand, 42800364 - 42800744
Alignment:
| Q |
20 |
aattggtcacacatgcatgtttggtaccatagttggttggtttgtcagaatcacggtgaaccaccatgattctgatatactatcgtgataccaaacatgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42800364 |
aattggtcacacatgcatgtttggtaccatagttggttggtttgtcagaatcacggtgaaccaccatgattctgatatactatcgtgataccaaacatgc |
42800463 |
T |
|
| Q |
120 |
acataaattttcatctgggtgtgatcaaaatcacnnnnnnnnn-attcaatcaaaatcagacacatacatacatagacactaaactaccttggtttttag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42800464 |
acataaattttcatctgggtgtgatcaaaatcactttttcttttattcaatcaaaatcagacacatacatacatagacactaaactaccttggtttttag |
42800563 |
T |
|
| Q |
219 |
caggcaaaggaaaagcagaaacaggtatgctttcaaaacaagcattaagtttgtcattaggacttaattgtgcctcttgaacatcccatagatcttcaac |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42800564 |
caggcaaaggaaaagcagaaacaggtatgctttcaaaacaagcattaagtttgtcattaggacttaattgtgcctcttgaacatcccatagatcttcaac |
42800663 |
T |
|
| Q |
319 |
tctcctcccaagtttggcttcagggctccttggcatctctctcattgtagccattgccattattccctcttcttctctctc |
399 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
42800664 |
tctcatcccaagtttggcttcagggctccttggcatctctctcattgtagccattgccattactccctcttcttttctctc |
42800744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University