View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19755_high_30 (Length: 388)
Name: NF19755_high_30
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19755_high_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 9 - 370
Target Start/End: Complemental strand, 37594590 - 37594229
Alignment:
| Q |
9 |
gacatcatcacataagcaccagaattataaggatccagattcaaaatgctcccagcagccagttcccccaatttcacgtttgaatgaatattacagccaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37594590 |
gacatcatcacataagcaccagaattataaggatccagattcaaaatgctcctagcagccagttcccccaatttcacgtttgaatgaatattacagccaa |
37594491 |
T |
|
| Q |
109 |
caagaaaagcaccccagatgctggcatctgcctcaaatggcatctcttggattactttgcaagctctctgcagttgacctgctcgactcataacatcaac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
37594490 |
caagaaaagcaccccagatgctggcatctgcctcaaatggcatctcttggattactttgcaagctctcagcaattgacctgctcgactcataacatcaac |
37594391 |
T |
|
| Q |
209 |
aacacaagaatagtgttcagaccttggcagaataccatatttatggaccatcaggtcaaaaagattcactgtctcatcaaccttcccagcacgacaacag |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37594390 |
aacacaagaatagtgttcagaccttggcagaataccatatttatggaccatcaggtcaaaaagattcactgtctcatcaaccttcccagcacgacaacag |
37594291 |
T |
|
| Q |
309 |
gcagatagcaaattcaggaaagtaatgccatcaggtgtaacaccggctgttaccatatggtc |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37594290 |
gcagatagcaaattcaggaaagtaatgccatcaggtgtaacaccggctgttaccatatggtc |
37594229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University