View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19755_high_48 (Length: 266)
Name: NF19755_high_48
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19755_high_48 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 34383198 - 34382951
Alignment:
| Q |
1 |
ccaaattgaagagaaaattgattctgacagacaaccattccatggtggcatagttgtgaaaggctacccgagaataatcgtcaattagaaccataacctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34383198 |
ccaaattgaagagaaaattgattctgacggacaaccattccatggtggcatagttgtgaaaggctacccgagaataatcgtcaattagaaccataacctt |
34383099 |
T |
|
| Q |
101 |
ggtcaggaatattttctcttgtttgaaacaacggatagtggcagccccagcaattgactctgagaagtgatgcaagattggtgcctttcggatccccacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34383098 |
ggtcaggaatattttctcttgtttgaaacaacggatagtggcagccccagcaattgactctgagaagtgatgcaagattggtgcctttcggatccccacc |
34382999 |
T |
|
| Q |
201 |
atcctggccaattccctagccgtagtgatgtaataggcctgcaaataa |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34382998 |
atcctggccaattccctagccgtagtgatgtaataggcctgcaaataa |
34382951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University