View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19755_high_64 (Length: 239)
Name: NF19755_high_64
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19755_high_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 33141250 - 33141031
Alignment:
| Q |
1 |
agcgaatattaaagaaagcaattcgaaaatgagaaggaagtaccagaaggggacattagaatgagttgttgaggtttgggaatggaatcatcatgaactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33141250 |
agcgaatattaaagaaagcaattcgaaaatgagaaggaagtaccagaaggggacatgagaatgagttgttgaggtttgggaatggaatcatcatgaactt |
33141151 |
T |
 |
| Q |
101 |
tgatgctgatgctgccaccagttcctgaaacccatcccaaactgtaaaagtggcgacacagttccgccatcagagctttggtttccttcactgccttccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33141150 |
tgatgctgatgctgccaccagttcctgaaacccatcccaaactgtaaaagtggcgacacagttccgccatcagagctttggtttccttcactgccttccc |
33141051 |
T |
 |
| Q |
201 |
ttccagatacgcctgagatg |
220 |
Q |
| |
|
||| |||||||||||||||| |
|
|
| T |
33141050 |
ttcaagatacgcctgagatg |
33141031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University