View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19755_high_77 (Length: 213)
Name: NF19755_high_77
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19755_high_77 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 9 - 195
Target Start/End: Complemental strand, 21378156 - 21377970
Alignment:
| Q |
9 |
gtcgaagaatatttgagtctttcaacaaatattggtgaatcattcgtcaagaagagtcggcaattgccatgtgctaatgattataacttatttatcaata |
108 |
Q |
| |
|
|||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21378156 |
gtcgaatattatttgagtctttcgacaaatattggtgaatcattcgtcaagaagagtcggcaattgccatgtgctaatgattataacttatttatcaata |
21378057 |
T |
 |
| Q |
109 |
cattgtgaacattttagatggataagctattaagttaagatacacacaatgttttgaggatactagaaggcttttagttggatccac |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21378056 |
cattgtgaacattttagatggataagctattaagttaagatacacacaatgttttgaggatactagaaggcttttagttggatccac |
21377970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University