View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19755_high_79 (Length: 205)
Name: NF19755_high_79
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19755_high_79 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 19 - 195
Target Start/End: Original strand, 42898828 - 42899003
Alignment:
| Q |
19 |
agttttgtttcactttctcagttatgtttattatgagctgtttttgaagtttgagcagcaggttttgtttcgtattcaactatggtttatgttaattgac |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42898828 |
agttttgttgcactttctcagttatgtttattatgagctgtttttgaagtttgagcagcaggttttgtttcgtattcaactatggtttatgttaatcgac |
42898927 |
T |
|
| Q |
119 |
ttgcttgnnnnnnnntatatcctatagccagtaatgacacttttaaggccctatatctatccatgtcctttgcttct |
195 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
42898928 |
ttgcttgaaaaaaaa-aaatcctatagccagtaatgacacttttaaggccctatatctatccatgtcttttggttct |
42899003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 19 - 125
Target Start/End: Original strand, 38632531 - 38632637
Alignment:
| Q |
19 |
agttttgtttcactttctcagttatgtttattatgagctgtttttgaagtttgagcagcaggttttgtttcgtattcaactatggtttatgttaattgac |
118 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38632531 |
agttttgttgcactttctcagttatgtttgttatgagctgtttttgaagtttgagcagcagtttttgtttcgtattcaactatggtttatgttaattgac |
38632630 |
T |
|
| Q |
119 |
ttgcttg |
125 |
Q |
| |
|
||||||| |
|
|
| T |
38632631 |
ttgcttg |
38632637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University