View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19755_high_80 (Length: 204)
Name: NF19755_high_80
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19755_high_80 |
 |  |
|
| [»] scaffold0618 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 37119312 - 37119110
Alignment:
| Q |
1 |
agtaaatctcattgtgtgtattttgttgattattggatcttcaattggaatttcagcttattgggctaatagtagtgagcataagtggattggatataca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37119312 |
agtaaatctcattgtgtgtattttgttgattattggatcttcaattggaatttcagcttattgggctaatagtagtgagcataagtggattggatataca |
37119213 |
T |
 |
| Q |
101 |
atctttgttccattgtggtttttagggacaggtgctctttggctttttgttccaatggcaaagaagcctaagttatggggagttcctttggttcatttgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
37119212 |
atctttgttccattgtggtttttagggacaggtgctctttggctttttgttccaatggcaaagaagcctaagttatggggagttcctttggttccttggc |
37119113 |
T |
 |
| Q |
201 |
tac |
203 |
Q |
| |
|
||| |
|
|
| T |
37119112 |
tac |
37119110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 37111057 - 37110858
Alignment:
| Q |
1 |
agtaaatctcattgtgtgtattttgttgattattggatcttcaattggaatttcagcttattgggctaatagtagtgagcataagtggattggatataca |
100 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||| ||||||||| ||| |||||| ||||||||||| || |
|
|
| T |
37111057 |
agtaaatctcattgtgtgtcttgtgttgattattggatcttcaattggactttcagcttcttgggctaacagt---gagcatggatggattggatacgca |
37110961 |
T |
 |
| Q |
101 |
atctttgttccattgtggtttttagggacaggtgctctttggctttttgttccaatggcaaagaagcctaagttatggggagttcctttggttcatttgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || || |
|
|
| T |
37110960 |
atctttgttccattgtggtttttagggacaggtgctctttggctttttgttccaatggcaaagaagcctaaactatggggagttcctttggttccttggc |
37110861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 62; Significance: 5e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 98 - 203
Target Start/End: Original strand, 29258661 - 29258766
Alignment:
| Q |
98 |
acaatctttgttccattgtggtttttagggacaggtgctctttggctttttgttccaatggcaaagaagcctaagttatggggagttcctttggttcatt |
197 |
Q |
| |
|
||||| |||||||||||||||||||| || || |||| ||||||||||| |||||||||||||||||||||||| ||||||||||||| | ||||| || |
|
|
| T |
29258661 |
acaatttttgttccattgtggttttttggaaccggtggtctttggctttgtgttccaatggcaaagaagcctaaattatggggagttcatgtggtttctt |
29258760 |
T |
 |
| Q |
198 |
tgctac |
203 |
Q |
| |
|
|||||| |
|
|
| T |
29258761 |
tgctac |
29258766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0618 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: scaffold0618
Description:
Target: scaffold0618; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 98 - 171
Target Start/End: Original strand, 2991 - 3064
Alignment:
| Q |
98 |
acaatctttgttccattgtggtttttagggacaggtgctctttggctttttgttccaatggcaaagaagcctaa |
171 |
Q |
| |
|
||||| |||||||||||||||||||| || || |||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2991 |
acaatttttgttccattgtggttttttggaaccggtggtctttggctttgtgttccaatggcaaagaagcctaa |
3064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University