View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19755_low_45 (Length: 295)
Name: NF19755_low_45
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19755_low_45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 125 - 277
Target Start/End: Original strand, 1570129 - 1570276
Alignment:
| Q |
125 |
gtaaacccttacttaacaagggttttgtcaaatgggattggacagaagaactactttgttgaagtgttgatgagtgtgtcaacatgtgggattgcacact |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
1570129 |
gtaaacccttacttaacaagggttttgtcaaatgggattggactgaagaactactttgttgaagtgttgatgaatgtggcaacatgtgggattgcacac- |
1570227 |
T |
|
| Q |
225 |
cctttttgtaagatgtcgatatcttcaatttaagattagtggtgggtggaacc |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1570228 |
----tttgtaagatgtcgatatcttcaatttaagattagtggtgggtggaacc |
1570276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 1558427 - 1558488
Alignment:
| Q |
1 |
ttgtcttatgagaagactctgacttcagatgaagttgattctagc-tttttggtaagtgaac |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1558427 |
ttgtcttatgagaagactctgacttcagatgaagttgattctagcttttttggtaagtgaac |
1558488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 136 - 230
Target Start/End: Complemental strand, 30177443 - 30177349
Alignment:
| Q |
136 |
cttaacaagggttttgtcaaatgggattggacagaagaactactttgttgaagtgttgatgagtgtgtcaacatgtgggattgcacactcctttt |
230 |
Q |
| |
|
|||| ||||||||||||| ||||||| |||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30177443 |
cttaccaagggttttgtcgaatgggactggacataagaactactttgttgaagtgttgatgagtgtgacaacatgtgggattgcacactcctttt |
30177349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University