View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19755_low_52 (Length: 253)
Name: NF19755_low_52
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19755_low_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 9e-85; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 11 - 184
Target Start/End: Original strand, 36269595 - 36269769
Alignment:
| Q |
11 |
aagaatatagagaggacgaggcttggggtaaagatacttttagcaagtaaaatatattcatgttgttatcaaattcttttttccaggacaaggcaaagac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36269595 |
aagaatatagagaggacgaggcttggggtaaagatacttttagcaagtaaaatatattcatgttgttatcaaattcttttttccaggacaaggcaaagac |
36269694 |
T |
|
| Q |
111 |
tcttacaactcaaacttcattcacgattttttccc-tttctatccaacaaccccaagtataaatttttgatgtaa |
184 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36269695 |
tcttacacctcaaacttcattcacgattttttcccttttctatccaacaaccacaagtataaatttttgatgtaa |
36269769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 200 - 237
Target Start/End: Original strand, 36269809 - 36269846
Alignment:
| Q |
200 |
gtctaaaatgatggcacaaggattgttaggagttttct |
237 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36269809 |
gtctcaaatgatggcacaaggattgttaggagttttct |
36269846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University