View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19755_low_56 (Length: 250)
Name: NF19755_low_56
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19755_low_56 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 46333287 - 46333528
Alignment:
| Q |
1 |
aaccaatatatatgtacatcaattccaccgggactacgcgggcggatggagaaacggtaattggctgacaccttgcttgttatattgaaatgtttgatgt |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46333287 |
aaccaatatatatttacatcaattccaccgggactacgcgggcggatggagaaacggtaattggctgacaccttgcttgttatattgaaatgtttgatgt |
46333386 |
T |
 |
| Q |
101 |
tctgtccgcacttggacacgtgctttgtatggttcaactcatgcatttattgtttttgactttaggtggcgatggaatcagaaggttttgccatttatga |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46333387 |
tctgtccacacttggacacgtgctttgtatggttcaactcatgcatttattgtttttgactttaggtggcgatggagtcagaaggttttgccatttatga |
46333486 |
T |
 |
| Q |
201 |
tgcaatgatgcagatgaaaacaactcaggtttgtttcttctcact |
245 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
46333487 |
tgcaatgatgcagatgaa---aactgaggtttgtttcttctcact |
46333528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University