View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19755_low_58 (Length: 250)
Name: NF19755_low_58
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19755_low_58 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 35720179 - 35719955
Alignment:
| Q |
18 |
gtaagtagggccaaaaattcttagcagtaaggttaagaacagttggcagacgcatgatgatgcctagtgggacacaagggaaattaaggttaattagtac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35720179 |
gtaagtagggccaaaaattcttagcagtaaggttaagaacagttggcagacgcatgatgatgcctagtgggacacaagggaaattaaggttaattagtac |
35720080 |
T |
|
| Q |
118 |
ttaatagaggggtggtgatttattatactctctaattatgtcatgtgattagatgtatccaagttggcttagggatatat--atatctatgtgatgcatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35720079 |
ttaatagaggggtggtgatttattatactctctaattatgtcatgtgattggatgtatccaacttggcttagggatatatatatatctatgtgatgcatg |
35719980 |
T |
|
| Q |
216 |
catgtgttacatttcaaagtctgtg |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
35719979 |
catgtgttacatttcaaagtctgtg |
35719955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University