View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19755_low_68 (Length: 236)
Name: NF19755_low_68
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19755_low_68 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 31 - 225
Target Start/End: Complemental strand, 1342950 - 1342756
Alignment:
| Q |
31 |
ttcaagtttgaagggaatttttaccacttaactgtaagacattctatgttgtgtgtacggaacaaaatgcagggcagtaaaatgtcaacgggaaaataag |
130 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1342950 |
ttcaagttttaagggaagttttaccacttaactgtaagacattctatgttgtgtgtacggaacaaaatgcagggcagtaaaatgtcaacgggaaaataag |
1342851 |
T |
|
| Q |
131 |
attattgttgctgaggtgagaatgctatgctggatgaggtgtcatacatgacaagatagaattagggaaaaagaatcggtagttcctttatagaa |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1342850 |
attattgttgctgaggtgagaatgctatgctggatgaggtgtcatacatgacaagatagaattagggaaaaagaatcggtagttcctttatagaa |
1342756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University