View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19755_low_69 (Length: 235)

Name: NF19755_low_69
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19755_low_69
NF19755_low_69
[»] chr2 (1 HSPs)
chr2 (81-215)||(7889110-7889244)


Alignment Details
Target: chr2 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 81 - 215
Target Start/End: Complemental strand, 7889244 - 7889110
Alignment:
81 tggtggaacttattctttatttttcatctgaatcttttcttattacaggggaaccatcttagacacaaattagacaacctgataacgatggtaatgatca 180  Q
    ||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||||||||||||||    
7889244 tggtggaacttattctttattttccatctgaatcttttcttatcacaagggaaccaacttagacacaaattagacaacctgataacgatggtaatgatca 7889145  T
181 acagcaacatccccgttagttccatccaatattgt 215  Q
    |||||||||||||| ||||||||||||||||||||    
7889144 acagcaacatccccattagttccatccaatattgt 7889110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University