View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19755_low_69 (Length: 235)
Name: NF19755_low_69
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19755_low_69 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 81 - 215
Target Start/End: Complemental strand, 7889244 - 7889110
Alignment:
| Q |
81 |
tggtggaacttattctttatttttcatctgaatcttttcttattacaggggaaccatcttagacacaaattagacaacctgataacgatggtaatgatca |
180 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7889244 |
tggtggaacttattctttattttccatctgaatcttttcttatcacaagggaaccaacttagacacaaattagacaacctgataacgatggtaatgatca |
7889145 |
T |
 |
| Q |
181 |
acagcaacatccccgttagttccatccaatattgt |
215 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
7889144 |
acagcaacatccccattagttccatccaatattgt |
7889110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University