View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19755_low_73 (Length: 227)
Name: NF19755_low_73
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19755_low_73 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 41 - 211
Target Start/End: Complemental strand, 21930512 - 21930342
Alignment:
| Q |
41 |
gtgcatgaagtactgttaaaccctacttgaatgctcctctaaaaggaacatcaacataagagacatagtacnnnnnnnacctatctaattcaccacaata |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21930512 |
gtgcatgaagtactgttaaaccctacttgaatgctcctctaaaaggaacatcaacataagagacatagtactttttttacctatctaattcaccacaata |
21930413 |
T |
|
| Q |
141 |
ccctaacccttgtaatctctctttcctttttgtctcatcctttacattactttactgtttctttctctctg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21930412 |
ccctaacccttgtaatctctctttcctttttgtctcatcctttacattactttactgtttctttctctctg |
21930342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 93
Target Start/End: Original strand, 43168917 - 43168945
Alignment:
| Q |
65 |
acttgaatgctcctctaaaaggaacatca |
93 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43168917 |
acttgaatgctcctctaaaaggaacatca |
43168945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University