View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19755_low_75 (Length: 226)
Name: NF19755_low_75
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19755_low_75 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 32057917 - 32057712
Alignment:
| Q |
1 |
agtttaaagtgttaaattaatttttagaaagttctgaaaatattttattttttaattgtctattgaacttttatctaagatcaaattagagaagctaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32057917 |
agtttaaagtgttaaattaatttttagaaagttctgaaaatattttattttttaattgtcaattgaacttttatctaagatcaagttagagaagctaaca |
32057818 |
T |
|
| Q |
101 |
ttttcttttagactttgtttatttaaccttatcaataaatatataaataattagaagctttgttattcacctatgtcaatttatacagattaggacacat |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
32057817 |
ttttcttttagacttagtttatttaaccttattaataaatatataaataattagaagctttgttattcacctatgtcaatttatacagtttagggcacat |
32057718 |
T |
|
| Q |
201 |
gttatt |
206 |
Q |
| |
|
|||||| |
|
|
| T |
32057717 |
gttatt |
32057712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University