View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19755_low_76 (Length: 226)
Name: NF19755_low_76
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19755_low_76 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 3680214 - 3680156
Alignment:
| Q |
18 |
caatcagcactgatcccaatagcaaaatgtatatgcaagaaatctcacatactggttatat |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3680214 |
caatcagcactgatcccaatagcaaaatgtatatgcaagaaa--tcacatactggttatat |
3680156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 215
Target Start/End: Complemental strand, 3679978 - 3679942
Alignment:
| Q |
179 |
ttggatgaaggttggatttcgcttatgtctgatgatg |
215 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3679978 |
ttggatgaaggtcggatttcgcttatgtctgatgatg |
3679942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University