View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19755_low_78 (Length: 213)

Name: NF19755_low_78
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19755_low_78
NF19755_low_78
[»] chr7 (1 HSPs)
chr7 (14-197)||(31692105-31692288)


Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 197
Target Start/End: Original strand, 31692105 - 31692288
Alignment:
14 gagatgaaagtgtgaaactattggaaggaagtttaagaaaaggtgacgaatcaggagactctaccgagttacaaactgtaaaggaggaacttgaggccgc 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31692105 gagatgaaagtgtgaaactattggaaggaagtttaagaaaaggtgacgaatcaggagactctaccgagttacaaactgtaaaggaggaacttgaggccgc 31692204  T
114 aataaaagaattagctttgattagagatgaaggttttcagtttatggcttctatggatgttataagaaatgagttgaagcatgt 197  Q
    ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
31692205 aacgaaagaattagctttgattagagatgaaggttttcagtttatggcttctatggatgttataagaaatgagctgaagcatgt 31692288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University