View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19755_low_80 (Length: 209)
Name: NF19755_low_80
Description: NF19755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19755_low_80 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 12456019 - 12455840
Alignment:
| Q |
15 |
acagacccaacccc-tgagcaaaacgtcactgaagatcaacgacagcatgatctcaactaaacattgattcgcatatcacggcgatatacattcctactt |
113 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12456019 |
acagacccaactccatgagcaaaacgtcactgaagatcaacgactgcatgatctcaactaaacattgattcgcatatcacggcgatatacattccgactt |
12455920 |
T |
|
| Q |
114 |
ataactttctcaacagactttcccaccattttacctcggcagttcagttgtattaggactttccttccaccggaagcaag |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12455919 |
ataactttctcaacagactttcccaccattttacctgggcagttcaattgtattaggactttccttccaccggaagcaag |
12455840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University