View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19756_high_11 (Length: 378)
Name: NF19756_high_11
Description: NF19756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19756_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 3e-85; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 212 - 371
Target Start/End: Original strand, 32094036 - 32094195
Alignment:
| Q |
212 |
ataggtgagagagagtgaattgctacaatggcaaacaagatggaaaaaatggcatcaattgatgcacagcttaggcaattggttcctgcaaaagtgagtg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32094036 |
ataggtgagagagagtgaattgctacaatggcaaacaagatggaaaaaatggcatcaattgatgcacagcttaggcaattggttcctgcaaaagtgagtg |
32094135 |
T |
|
| Q |
312 |
aagatgataaacttattgagtatgatgctttgttgttggatcggtttcttgatattcttc |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32094136 |
aagatgataaacttattgagtatgatgctttgttgttggatcggtttcttgatattcttc |
32094195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 19 - 86
Target Start/End: Original strand, 32093843 - 32093910
Alignment:
| Q |
19 |
atccattgatgatattcatcatgtcaaatctctttcataattttcgggatttgattataatttaagga |
86 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32093843 |
atccattgatgatattcaacatgtcaaatctctttcataattttcgggatttgattataatttaagga |
32093910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 314 - 371
Target Start/End: Complemental strand, 39540891 - 39540834
Alignment:
| Q |
314 |
gatgataaacttattgagtatgatgctttgttgttggatcggtttcttgatattcttc |
371 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
39540891 |
gatgataaacttgtggagtatgatgctttgttgttggataggtttcttgacattcttc |
39540834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 66; Significance: 4e-29; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 254 - 371
Target Start/End: Original strand, 22564702 - 22564819
Alignment:
| Q |
254 |
gaaaaaatggcatcaattgatgcacagcttaggcaattggttcctgcaaaagtgagtgaagatgataaacttattgagtatgatgctttgttgttggatc |
353 |
Q |
| |
|
||||| |||||||| || ||||| |||||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| | ||||| | |
|
|
| T |
22564702 |
gaaaagatggcatccatcgatgctcagcttcggcaattggttcctgcaaaagtgagtgaggatgataaactggttgagtatgatgctttgctcttggacc |
22564801 |
T |
|
| Q |
354 |
ggtttcttgatattcttc |
371 |
Q |
| |
|
| || ||||||||||||| |
|
|
| T |
22564802 |
gtttccttgatattcttc |
22564819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 220 - 249
Target Start/End: Complemental strand, 24586583 - 24586554
Alignment:
| Q |
220 |
gagagagtgaattgctacaatggcaaacaa |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24586583 |
gagagagtgaattgctacaatggcaaacaa |
24586554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University