View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19756_high_25 (Length: 291)

Name: NF19756_high_25
Description: NF19756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19756_high_25
NF19756_high_25
[»] chr5 (3 HSPs)
chr5 (67-140)||(3263601-3263674)
chr5 (214-273)||(3263336-3263395)
chr5 (20-53)||(3263675-3263708)


Alignment Details
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 67 - 140
Target Start/End: Complemental strand, 3263674 - 3263601
Alignment:
67 gtatttataatctagttttcattatgttgtattcttctctcttcttcatggatttatgaagcatgaacaccaga 140  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||    
3263674 gtatttataatctagttttcattatgttgtattcttctcccttcttcatggatttatgaagcacgaacaccaga 3263601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 214 - 273
Target Start/End: Complemental strand, 3263395 - 3263336
Alignment:
214 atactaatttgagatgatagaagtaattgaatgtaatgacatgtgtcatgttagtgtgag 273  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||    
3263395 atactaatttgagatgatagaagtaattgaatgtaacgacatgtgtcatggtagtgtgag 3263336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 53
Target Start/End: Complemental strand, 3263708 - 3263675
Alignment:
20 tatatattagtgttaaggctggtatttagttttt 53  Q
    |||||||||||||||| |||||||||||||||||    
3263708 tatatattagtgttaaagctggtatttagttttt 3263675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University