View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19756_high_25 (Length: 291)
Name: NF19756_high_25
Description: NF19756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19756_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 67 - 140
Target Start/End: Complemental strand, 3263674 - 3263601
Alignment:
| Q |
67 |
gtatttataatctagttttcattatgttgtattcttctctcttcttcatggatttatgaagcatgaacaccaga |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
3263674 |
gtatttataatctagttttcattatgttgtattcttctcccttcttcatggatttatgaagcacgaacaccaga |
3263601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 214 - 273
Target Start/End: Complemental strand, 3263395 - 3263336
Alignment:
| Q |
214 |
atactaatttgagatgatagaagtaattgaatgtaatgacatgtgtcatgttagtgtgag |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
3263395 |
atactaatttgagatgatagaagtaattgaatgtaacgacatgtgtcatggtagtgtgag |
3263336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 53
Target Start/End: Complemental strand, 3263708 - 3263675
Alignment:
| Q |
20 |
tatatattagtgttaaggctggtatttagttttt |
53 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
3263708 |
tatatattagtgttaaagctggtatttagttttt |
3263675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University