View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19756_high_37 (Length: 210)
Name: NF19756_high_37
Description: NF19756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19756_high_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 26 - 194
Target Start/End: Original strand, 47154418 - 47154586
Alignment:
| Q |
26 |
agaagagaagctttatcacatgcaagaaaaaatcgcgttagagaacgatatgacatctaaatcctaatgagagactaatcccaatcaccagttaattttt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47154418 |
agaagagaagctttatcacatgcaagaaaaaatcgcgttagagaacgatatgacatctaaatcctaatgagagactaatcccaatcaccagttaattttt |
47154517 |
T |
 |
| Q |
126 |
gacacatattatactataaaattggcataccatcacttcattatatatggttaaaaatgtagatatcat |
194 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47154518 |
gacacctattatactataaaattggcataccatcacttcattatatatggttaaaaatgtagatatcat |
47154586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University