View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19756_high_39 (Length: 206)
Name: NF19756_high_39
Description: NF19756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19756_high_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 4e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 21181386 - 21181269
Alignment:
| Q |
1 |
atgtatctcatattggtaaccagattaatttgtttcttctcaaaaggcatactggatataagtgctgataggcttgccaatattggagtagttggacaat |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| || ||||||||||| |||| |||||||||||||||||| |
|
|
| T |
21181386 |
atgtatctcatattggtaaccagactaatttgtttcttctcaaaaggcatattggatataactgttgataggcttgtcaatcttggagtagttggacaat |
21181287 |
T |
 |
| Q |
101 |
taccattggtggggtagc |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
21181286 |
taccattggtggggtagc |
21181269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 111 - 206
Target Start/End: Complemental strand, 21180591 - 21180496
Alignment:
| Q |
111 |
ggggtagcattccccaagtgttttgaatgatttcattagaaattgactgggttgacatgaatataggttttgttagcttattgatgtttgatcact |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21180591 |
ggggtagcattccccaagtgttttgaatgatttcattagaaattgactgggttgacatgaatataggttttgttagcttatggatgtttgatcact |
21180496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University