View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19756_low_11 (Length: 378)

Name: NF19756_low_11
Description: NF19756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19756_low_11
NF19756_low_11
[»] chr2 (3 HSPs)
chr2 (212-371)||(32094036-32094195)
chr2 (19-86)||(32093843-32093910)
chr2 (314-371)||(39540834-39540891)
[»] chr8 (2 HSPs)
chr8 (254-371)||(22564702-22564819)
chr8 (220-249)||(24586554-24586583)


Alignment Details
Target: chr2 (Bit Score: 160; Significance: 3e-85; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 212 - 371
Target Start/End: Original strand, 32094036 - 32094195
Alignment:
212 ataggtgagagagagtgaattgctacaatggcaaacaagatggaaaaaatggcatcaattgatgcacagcttaggcaattggttcctgcaaaagtgagtg 311  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32094036 ataggtgagagagagtgaattgctacaatggcaaacaagatggaaaaaatggcatcaattgatgcacagcttaggcaattggttcctgcaaaagtgagtg 32094135  T
312 aagatgataaacttattgagtatgatgctttgttgttggatcggtttcttgatattcttc 371  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32094136 aagatgataaacttattgagtatgatgctttgttgttggatcggtttcttgatattcttc 32094195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 19 - 86
Target Start/End: Original strand, 32093843 - 32093910
Alignment:
19 atccattgatgatattcatcatgtcaaatctctttcataattttcgggatttgattataatttaagga 86  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
32093843 atccattgatgatattcaacatgtcaaatctctttcataattttcgggatttgattataatttaagga 32093910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 314 - 371
Target Start/End: Complemental strand, 39540891 - 39540834
Alignment:
314 gatgataaacttattgagtatgatgctttgttgttggatcggtttcttgatattcttc 371  Q
    |||||||||||| | |||||||||||||||||||||||| |||||||||| |||||||    
39540891 gatgataaacttgtggagtatgatgctttgttgttggataggtttcttgacattcttc 39540834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 66; Significance: 4e-29; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 254 - 371
Target Start/End: Original strand, 22564702 - 22564819
Alignment:
254 gaaaaaatggcatcaattgatgcacagcttaggcaattggttcctgcaaaagtgagtgaagatgataaacttattgagtatgatgctttgttgttggatc 353  Q
    ||||| |||||||| || ||||| |||||| |||||||||||||||||||||||||||| |||||||||||  ||||||||||||||||| | ||||| |    
22564702 gaaaagatggcatccatcgatgctcagcttcggcaattggttcctgcaaaagtgagtgaggatgataaactggttgagtatgatgctttgctcttggacc 22564801  T
354 ggtttcttgatattcttc 371  Q
    | || |||||||||||||    
22564802 gtttccttgatattcttc 22564819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 220 - 249
Target Start/End: Complemental strand, 24586583 - 24586554
Alignment:
220 gagagagtgaattgctacaatggcaaacaa 249  Q
    ||||||||||||||||||||||||||||||    
24586583 gagagagtgaattgctacaatggcaaacaa 24586554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University