View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19756_low_16 (Length: 348)
Name: NF19756_low_16
Description: NF19756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19756_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 336
Target Start/End: Original strand, 11263408 - 11263732
Alignment:
| Q |
1 |
agctaatattgtacatagatgtaagagtttgttcgaggagtggagatttgtacgttcaaatacaatgcagacaataaatcgaatttagaatggccgcgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
11263408 |
agctaatattgtacatagatgtaagagtttgttcgaggagtggagattggtacgtccaaatacaat-------------cgaatttagaatggccgcgtc |
11263494 |
T |
 |
| Q |
101 |
cactgagggatgagtttcaaatgtttatgggagcaaatgcgctgtggtttcagccaattacacattttagtattggtgaggcgatgagctcgc-ctcagc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
11263495 |
cactgagggatgagtttcaaatgtttatgggagcaaatgtgctgtggtttcagccaattacacattttagtattggtgaggcgatgagcttgctctcagc |
11263594 |
T |
 |
| Q |
200 |
tatcaaatggatgcaagagctgaatttcaaacaagttatcttctctttggattcaaagattgtgttc-gattctttcacctcgtcgcttctatcatttta |
298 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11263595 |
tatcaaatggatgcatgagctgaatttcaaacaagttatcttctctttggattcaaagattgtgttctgattctttcacctcgtcgcttctatcatttta |
11263694 |
T |
 |
| Q |
299 |
tccggatgtcatagtatttggttatcctttagtaataa |
336 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11263695 |
tccggatgtcatagtattcggttatcctttagtaataa |
11263732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University