View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19756_low_27 (Length: 287)
Name: NF19756_low_27
Description: NF19756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19756_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 35808753 - 35808485
Alignment:
| Q |
1 |
ctgtgaattctttggcttatgaagctgatgcaaggcttagagaccctgtctatggatgcataggtgctatagcacttttgcaaaggaagatggttgaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35808753 |
ctgtgaattctttggcttatgaagctgatgcaaggcttagagaccctgtctatggatgcataggtgctatagcacttttgcaaaggaagatggttgaact |
35808654 |
T |
|
| Q |
101 |
tcaacatgatcttgccattgcaaaggatcgtctggctcgttgcgctgcggctgctgctactcctacttcttctttttccaatgatatgatgaattcaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35808653 |
tcaacatgatcttgccattgcaaaggatcgcctggctcgttgcgctgcggctgctgctactcctacttcttctttttccaatgatatgatgaattcaaat |
35808554 |
T |
|
| Q |
201 |
gttagtttgccaccttttcctgagtttttcacttgcagtgacttcagtgataatttaagtcacagttct |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35808553 |
gttagtttgccaccttttcctgagtttttcacttgcagtgacttcagtgataatttaagtcacagttct |
35808485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 3 - 142
Target Start/End: Complemental strand, 32036384 - 32036245
Alignment:
| Q |
3 |
gtgaattctttggcttatgaagctgatgcaaggcttagagaccctgtctatggatgcataggtgctatagcacttttgcaaaggaagatggttgaacttc |
102 |
Q |
| |
|
||||||||| | |||||||||||||| ||||||||||||||||| || || |||||||| ||| | ||||| | ||||||||||||||| | ||||||| |
|
|
| T |
32036384 |
gtgaattctcttgcttatgaagctgaagcaaggcttagagacccagtttacggatgcattggttccatagctatgttgcaaaggaagatgatggaacttc |
32036285 |
T |
|
| Q |
103 |
aacatgatcttgccattgcaaaggatcgtctggctcgttg |
142 |
Q |
| |
|
| |||||| | |||||||| ||||| ||||| |||||||| |
|
|
| T |
32036284 |
agcatgatttggccattgctaaggaacgtcttgctcgttg |
32036245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University