View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19756_low_32 (Length: 253)
Name: NF19756_low_32
Description: NF19756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19756_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 13110696 - 13110930
Alignment:
| Q |
1 |
gaactttcattcaaaaaatttaatgtgaaattaattctcaaattcaagaatataagaataaatgagaatatgtctaaatgtaaataattgagtttt---- |
96 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13110696 |
gaactttcattcaaaatatttaatgtgaaattaattctcaaattcaagaatataagaataaatgagaatatgtctaaatgtaaataattgagtttttttt |
13110795 |
T |
 |
| Q |
97 |
-ctaaatgagaatatgtctactatgtaaataattcaccattgtttatcaattaaaatgattctttatgaacttttttagttgttgctagtgtgtgcgtgn |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13110796 |
tctaaatgagaatatgtctactatgtaaataattcaccattgtttatcaattaaaatgattctttatgaacttttttagttgttgctagcgtgtgcgtg- |
13110894 |
T |
 |
| Q |
196 |
nnnnnncttccaacttttgcattaaccgaccttatc |
231 |
Q |
| |
|
||||||||||||||||||| |||||||||| |
|
|
| T |
13110895 |
ttttttcttccaacttttgcattaatcgaccttatc |
13110930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University