View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19756_low_35 (Length: 231)
Name: NF19756_low_35
Description: NF19756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19756_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 16 - 156
Target Start/End: Complemental strand, 52002142 - 52002002
Alignment:
| Q |
16 |
atattcatagagatgaaagaccacatgaaccctttctcaagagaggaactgaacccgactccgatgatgcctcttcttctaaacgcacaaaactctacaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52002142 |
atattcatagagatgaaagaccacatgaaccctttctcaagagaggaacggaacccgactccgatgatgcctcttcttctaaacgcacaaaactctacaa |
52002043 |
T |
 |
| Q |
116 |
ctttgaaaacacttccgatccaaaaggaaagaaaccactca |
156 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52002042 |
ctttgaaaacacttctgatccaaaaggaaagaaaccactca |
52002002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 217
Target Start/End: Complemental strand, 52002003 - 52001974
Alignment:
| Q |
188 |
cattgatgatcatcatcagaggaaggaaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
52002003 |
cattgatgatcatcatcagaggaaggaaat |
52001974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University