View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19756_low_36 (Length: 218)
Name: NF19756_low_36
Description: NF19756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19756_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 203
Target Start/End: Original strand, 27049558 - 27049744
Alignment:
| Q |
18 |
catgtttggcttgcagtctttcattttgtggcttannnnnnn-agtttattcacatgtgttcaacttattcaaaacatagctccgtgctcatagccactt |
116 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27049558 |
catgtttggcttgcagtctttcatttcgtggcttaatttgtttagtttattcacatgtgttcgacttattcaaaacatagctccgtgctcatagccactt |
27049657 |
T |
|
| Q |
117 |
tagcttagtggtgcgaaatatatggagaacaagttgattgcctaattgtccagtttcacctaagtgttatgttttcgtgaccttcat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27049658 |
tagcttagtggtgcgaaatatatggagaacaagttgattgcctaattgtccagtttcactgaagtgttatgttttcgtgaccttcat |
27049744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University