View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19756_low_38 (Length: 207)
Name: NF19756_low_38
Description: NF19756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19756_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 69; Significance: 4e-31; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 10 - 90
Target Start/End: Original strand, 9014815 - 9014895
Alignment:
| Q |
10 |
tatgcttcagcaactgcttactagattcatctgtgcatttgacttataggcatttggacctagcatgatgccttgtaaagt |
90 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9014815 |
tatgctccagcaactgcttactagattcatctgtgcacttgacttataggcatttggacctagaatgatgccttgtaaagt |
9014895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 13051765 - 13051690
Alignment:
| Q |
1 |
tctatcgtgtatgcttcagcaactgcttactagattcatctgtgcatttgacttataggcatttggacctagcatg |
76 |
Q |
| |
|
|||||| |||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13051765 |
tctatcttgtatgctccaacaactgcttactagattcatctgtgcatttgacttataggcatttggacctatcatg |
13051690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 71 - 179
Target Start/End: Complemental strand, 13051062 - 13050953
Alignment:
| Q |
71 |
agcatgatgccttgtaaagttagt-gttgaagatagatggtggccattcatcaagacctagataccgcagcatattcaggccagtctagaaaaccctaca |
169 |
Q |
| |
|
|||||| ||||||||||||| ||| |||||||||||||||||||||||||| |||||| ||||||| ||| |||||||| | ||||| |||||| | || |
|
|
| T |
13051062 |
agcatgctgccttgtaaagtcagtagttgaagatagatggtggccattcattaagaccaagataccaaagcctattcaggtctgtctaaaaaacctttca |
13050963 |
T |
 |
| Q |
170 |
taatatcata |
179 |
Q |
| |
|
| |||||||| |
|
|
| T |
13050962 |
ttatatcata |
13050953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University