View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19757_high_48 (Length: 383)
Name: NF19757_high_48
Description: NF19757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19757_high_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 1 - 366
Target Start/End: Complemental strand, 53617269 - 53616904
Alignment:
| Q |
1 |
aatgatgcgcttctaatattgcgtgacaaatatcttcccaacatttcccctgctgaaactcaacaccatcatccaattcaatctccggtaacatcgaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53617269 |
aatgatgcgcttctaatattgcgtgacaaatatcttcccaacatttcccctgctgaaactcaacaccatcatccaattcaatctccggtaacatcgaatc |
53617170 |
T |
|
| Q |
101 |
cggaacgtgtgcatcttgatacagcgtcaccgatcctcctcgccgaaccggaaaatacgaatcctgaaccgcaaacctatcaggaccgggaataacgccg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
53617169 |
tggaacgtgtgcatcttgatacagcgtcaccgatcctcctcgccgaaccggaaaatacgaatcctgaaccgcaaacctatcaggaccgggaataacaccg |
53617070 |
T |
|
| Q |
201 |
gaacgatacataggattttcatcgcatctcgtgaatttcatttcgagaaaaacagcgcaatcaggttttggaggtttaccgaatgaacctataatcggaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53617069 |
gaacgatacataggattttcatcgcatctcgtgaatttcatttcgagaaaaacagcgcaatcaggttttggaggtttaccgaatgaacctataatcggaa |
53616970 |
T |
|
| Q |
301 |
accaatcgcttatatcttcacctgataagatcctctttgcagaaacggttgcgattccgatcaaat |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
53616969 |
accaatcgcttatatcttcacctgataagatcctcttcgcagaaacggttgcgattccgatcaaat |
53616904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University