View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19757_high_88 (Length: 277)
Name: NF19757_high_88
Description: NF19757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19757_high_88 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 15 - 261
Target Start/End: Original strand, 40439324 - 40439570
Alignment:
| Q |
15 |
aagaacgaaggcagtggttccgtttgggaggaggaagggggagcacgacggaggcgtttgaggatacggattggtgggtcgggttgagattctggatcgg |
114 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40439324 |
aagaacgaaggcagtgattccgtttgggaggaggaagggggagcacgacggagacgtttgaggatacggattggtgggtcgggttgagattctggatcgg |
40439423 |
T |
|
| Q |
115 |
aatcggggacttcttgtgggaccgggtcgtggttgggggaggtagatggagaaggtggtggtgtatcgtcaagatcgagacctagggagaatgatggagc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40439424 |
aatcggggacttcttgtgggaccgggtcgtggttgggggaggtagatggagaaggtggtggtgtatcgtcaagatcgagacctagggagaatgatggagc |
40439523 |
T |
|
| Q |
215 |
ttcaaattcagccatggaaattgaaatccaaggattgagatcttgtt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40439524 |
ttcaaattcagccatggaaattgaaatccaaggattgtgatcttgtt |
40439570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University