View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19757_low_101 (Length: 247)
Name: NF19757_low_101
Description: NF19757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19757_low_101 |
 |  |
|
| [»] scaffold0080 (1 HSPs) |
 |  |  |
|
| [»] scaffold0062 (2 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
| [»] scaffold0381 (1 HSPs) |
 |  |  |
|
| [»] scaffold0214 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 3 - 227
Target Start/End: Original strand, 39191872 - 39192096
Alignment:
| Q |
3 |
ttgttaaaaagtggatgcacatatatcatttctctataaaaagcggaaactatgaaccaaattcacgttttacggttttgggaagaaaaagaagccgcac |
102 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
39191872 |
ttgttaaaaagtggatgtacatatatcatttctctataaaaagcggaaacagtgaaacaaattcacgttttacggttttgggaagaaaaagaagccacac |
39191971 |
T |
 |
| Q |
103 |
gtgtcacgagagaggggaagacacatgaacatagaagaacttcatcaacacttgcgattggaattaatttgaggagcaacgtcgacaacgacgaaactct |
202 |
Q |
| |
|
| |||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39191972 |
gcgtcacgagagaggggaaggcacatgaacatagaagaacttcatcaacaatagcgattggaattaatttaaggagcaacgtcgacaacgacgaaactct |
39192071 |
T |
 |
| Q |
203 |
atcgatttatttcttttactatgtt |
227 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39192072 |
atcgatttatttcttttactatgtt |
39192096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 233
Target Start/End: Complemental strand, 22937428 - 22937383
Alignment:
| Q |
188 |
caacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
|||||||| |||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
22937428 |
caacgacggaactctatcggtttattttctttactatgttgtttat |
22937383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 239
Target Start/End: Complemental strand, 21333169 - 21333121
Alignment:
| Q |
191 |
cgacgaaactctatcgatttatttcttttactatgttgtttatcccttt |
239 |
Q |
| |
|
||||| |||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
21333169 |
cgacggaactctatcggtttattttctttactatgttgtttattccttt |
21333121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 239
Target Start/End: Complemental strand, 21336185 - 21336137
Alignment:
| Q |
191 |
cgacgaaactctatcgatttatttcttttactatgttgtttatcccttt |
239 |
Q |
| |
|
||||| |||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
21336185 |
cgacggaactctatcggtttattttctttactatgttgtttattccttt |
21336137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0080 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: scaffold0080
Description:
Target: scaffold0080; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 74 - 240
Target Start/End: Original strand, 26706 - 26872
Alignment:
| Q |
74 |
acggttttgggaagaaaaagaagccgcacgtgtcacgagagaggggaagacacatgaacatagaagaacttcatcaacacttgcgattggaattaatttg |
173 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
26706 |
acggttttgggaagaaaacgaagccccacgtgtcacgagagaggggaaggcacatgaacatagaagaacttcatcaacagtagcgattggaattaatttg |
26805 |
T |
 |
| Q |
174 |
aggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttatccctttg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| ||||| |
|
|
| T |
26806 |
aggagcaacgtcgacaacgacgaaactctatcggtttatttcttttaatatgttgtttatctctttg |
26872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 9)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 25595165 - 25595103
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
25595165 |
ttgaggagcaacgccgacaacgacgaaactctatcggtttattttttttactatgttgtttat |
25595103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 18721789 - 18721727
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
18721789 |
ttgaggagcaacgccgacaacgacgaaactctatcggtttattttctttactatgttgtttat |
18721727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 176 - 233
Target Start/End: Complemental strand, 25591976 - 25591919
Alignment:
| Q |
176 |
gagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
25591976 |
gagcaacgtcgacaacgacgaaactctatcggtttattttctttactatgttgtttat |
25591919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 176 - 233
Target Start/End: Original strand, 23613157 - 23613214
Alignment:
| Q |
176 |
gagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||||||||||| ||||| |
|
|
| T |
23613157 |
gagcaacgtcgacaacgacgaaactctatcggtttattttctttactatgttatttat |
23613214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 18696448 - 18696386
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
18696448 |
ttgaggagcaaagtcatcaacgacgaaactctatcggtttattttctttactatgttgtttat |
18696386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 171 - 240
Target Start/End: Original strand, 31984593 - 31984662
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttatccctttg |
240 |
Q |
| |
|
|||||||| || | ||||||||||||| |||||||| ||||||| ||||||||||||||||| |||||| |
|
|
| T |
31984593 |
ttgaggagtaaagccgacaacgacgaagctctatcggtttattttctttactatgttgtttattcctttg |
31984662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 240
Target Start/End: Original strand, 31980958 - 31981027
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttatccctttg |
240 |
Q |
| |
|
|||||||| || | ||||||||||||| |||||||| || |||| ||| ||||||||||||| |||||| |
|
|
| T |
31980958 |
ttgaggagtaaagccgacaacgacgaagctctatcggttaattttctttcctatgttgtttattcctttg |
31981027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 324119 - 324155
Alignment:
| Q |
1 |
agttgttaaaaagtggatgcacatatatcatttctct |
37 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
324119 |
agttgtcaaaaagtggatgtacatatatcatttctct |
324155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 203 - 239
Target Start/End: Original strand, 30645103 - 30645139
Alignment:
| Q |
203 |
atcgatttatttcttttactatgttgtttatcccttt |
239 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
30645103 |
atcggtttatttcttttactatgttgtttattccttt |
30645139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 6e-18; HSPs: 7)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 23388607 - 23388545
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
23388607 |
ttgaggagcaacgccgacaacgacgaaactctatcggtttattttctttactatgttgtttat |
23388545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 9953583 - 9953645
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||| ||||| |||||||||||| |
|
|
| T |
9953583 |
ttgaggagcaacgccgacaacgacgaaactctatcggcttattttttttattatgttgtttat |
9953645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 239
Target Start/End: Complemental strand, 1126237 - 1126169
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttatcccttt |
239 |
Q |
| |
|
|||||||| || | || |||||||| |||||||||| |||||| |||||||||||||||||| ||||| |
|
|
| T |
1126237 |
ttgaggagtaaagccggcaacgacggaactctatcggtttattgtttttactatgttgtttattccttt |
1126169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 233
Target Start/End: Complemental strand, 5738575 - 5738530
Alignment:
| Q |
188 |
caacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
|||||||| |||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
5738575 |
caacgacggaactctatcggtttattttctttactatgttgtttat |
5738530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 233
Target Start/End: Original strand, 11410379 - 11410424
Alignment:
| Q |
188 |
caacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
|||||||| |||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
11410379 |
caacgacggaactctatcggtttattttctttactatgttgtttat |
11410424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 239
Target Start/End: Original strand, 23007779 - 23007848
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgattta-tttcttttactatgttgtttatcccttt |
239 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||| ||| |||||||| ||||||||| ||||| |
|
|
| T |
23007779 |
ttgaggagcaaaaccgacaacgacataactctatcgatttatttttttttactacgttgtttattccttt |
23007848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 239
Target Start/End: Complemental strand, 23780585 - 23780516
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgattta-tttcttttactatgttgtttatcccttt |
239 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||| ||| |||||||| ||||||||| ||||| |
|
|
| T |
23780585 |
ttgaggagcaaaaccgacaacgacataactctatcgatttatttttttttactacgttgtttattccttt |
23780516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 8)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 1503951 - 1503890
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
1503951 |
ttgaggagcaacgccgacatcgacgaaactctatcgatttattt-tcttactatgttgtttat |
1503890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 1507155 - 1507094
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||| ||||||| | |||||||||||||||| |
|
|
| T |
1507155 |
ttgaggagcaacgccgacatcgacgaaactctatcggtttattt-tcttactatgttgtttat |
1507094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 15704492 - 15704430
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
15704492 |
ttgaggagcaaagtcatcaacgacgaaactctatcggtttattttctttactatgttgtttat |
15704430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 15719746 - 15719684
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
15719746 |
ttgaggagcaaagtcatcaacgacgaaactctatcggtttattttctttactatgttgtttat |
15719684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 239
Target Start/End: Original strand, 26365530 - 26365597
Alignment:
| Q |
172 |
tgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttatcccttt |
239 |
Q |
| |
|
|||||||||| | |||||||| |||||||||||| ||||||| ||||| |||||||||||| ||||| |
|
|
| T |
26365530 |
tgaggagcaaagctgacaacgatgaaactctatcggtttattttttttattatgttgtttattccttt |
26365597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 4577449 - 4577511
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
|||||||| || | || |||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
4577449 |
ttgaggagtaaagccggcaacgacgaagctctatcgatttattttctttactatgttgtttat |
4577511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 239
Target Start/End: Complemental strand, 38005691 - 38005623
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttatcccttt |
239 |
Q |
| |
|
|||||||| || | || |||||||| |||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
38005691 |
ttgaggagtaaagccggcaacgacggaactctatcggtttattttctttactatgttgtttattccttt |
38005623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 233
Target Start/End: Original strand, 29435365 - 29435410
Alignment:
| Q |
188 |
caacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
|||||||| |||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
29435365 |
caacgacggaactctatcggtttattttctttactatgttgtttat |
29435410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 53404 - 53342
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
53404 |
ttgaggagcaaagtcatcaacgacgaaactctatcggtttattttctttactatgttgtttat |
53342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 68303 - 68241
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
68303 |
ttgaggagcaaagtcatcaacgacgaaactctatcggtttattttctttactatgttgtttat |
68241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 8)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 11703106 - 11703044
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
11703106 |
ttgaggagcaacgccgacatcgacgaaattctatcggtttattttctttactatgttgtttat |
11703044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 33400839 - 33400777
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
|||| |||||||||||| |||||||| | ||||||||||||||| ||||||||||||||||| |
|
|
| T |
33400839 |
ttgaagagcaacgtcgataacgacgagattctatcgatttattttctttactatgttgtttat |
33400777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 188 - 233
Target Start/End: Original strand, 27013894 - 27013939
Alignment:
| Q |
188 |
caacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27013894 |
caacgacggaactctatcgatttattttctttactatgttgtttat |
27013939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 233
Target Start/End: Complemental strand, 7642831 - 7642772
Alignment:
| Q |
174 |
aggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||||||||| ||| | | |||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
7642831 |
aggagcaacgtcggcaattatggaactttatcgatttattttttttactatgttgtttat |
7642772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 172 - 233
Target Start/End: Complemental strand, 37103722 - 37103661
Alignment:
| Q |
172 |
tgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
|||||||||| | || ||||| ||||||||||||| ||||||| |||| |||||||||||| |
|
|
| T |
37103722 |
tgaggagcaaagccggcaacggcgaaactctatcggtttattttctttattatgttgtttat |
37103661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 233
Target Start/End: Complemental strand, 40617185 - 40617140
Alignment:
| Q |
188 |
caacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
|||||||| |||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
40617185 |
caacgacggaactctatcggtttattttctttactatgttgtttat |
40617140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 3 - 36
Target Start/End: Complemental strand, 47540168 - 47540135
Alignment:
| Q |
3 |
ttgttaaaaagtggatgcacatatatcatttctc |
36 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
47540168 |
ttgttaaaaagtggatgtacatatatcatttctc |
47540135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 231
Target Start/End: Original strand, 10385562 - 10385622
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgttt |
231 |
Q |
| |
|
|||| ||||||| || |||||||| |||||||| |||||||| |||||||||||||||| |
|
|
| T |
10385562 |
ttgaagagcaacaccggcaacgacggaactctatgaatttattttttttactatgttgttt |
10385622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 9154414 - 9154476
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||||||||||||||| ||||| |||| |||| ||||||| |||||||||||||||||| |
|
|
| T |
9154414 |
ttgaggagcaacgtcgacatcgacggaactttatctgtttattttttttactatgttgtttat |
9154476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 36037484 - 36037422
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
|||| |||||||| |||||||| ||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
36037484 |
ttgatgagcaacgccgacaacgtcgaaactctatcgatttattttctttattatgttgtttat |
36037422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 42354930 - 42354869
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgattta-tttcttttactatgttgttt |
231 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||| |||| ||| |||||||||||||||| |
|
|
| T |
42354930 |
ttgaggagcaacgccgacatcgacgaaactctatcggtttatttttttttactatgttgttt |
42354869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 233
Target Start/End: Original strand, 538582 - 538644
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| || ||||||| |||||||| || ||||| |
|
|
| T |
538582 |
ttgaggagcaacgtagaaaacgacgaaactctaacggtttattttatttactatattttttat |
538644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 17529244 - 17529182
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||||||||| ||||||||| | |||||| ||| |||| || ||||||||||||||||| |
|
|
| T |
17529244 |
ttgaggagcaacgccgacaacgatgtaactctttcggtttacttgctttactatgttgtttat |
17529182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 233
Target Start/End: Complemental strand, 17532128 - 17532066
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||||||| | ||||||||||| |||||| ||| ||||||| |||||||||||| |||| |
|
|
| T |
17532128 |
ttgaggagcaatgccgacaacgacggaactctttcgctttattttctttactatgttgcttat |
17532066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 2280137 - 2280077
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgttt |
231 |
Q |
| |
|
||||||||||||| || |||||||| || ||||||| ||||||| ||||| ||||||||| |
|
|
| T |
2280137 |
ttgaggagcaacgccggcaacgacggaattctatcggtttattttctttacaatgttgttt |
2280077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 233
Target Start/End: Original strand, 44508425 - 44508469
Alignment:
| Q |
189 |
aacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
||||||| || ||||||||||||||| ||||||||||||||||| |
|
|
| T |
44508425 |
aacgacggaattctatcgatttattttctttactatgttgtttat |
44508469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 171 - 240
Target Start/End: Original strand, 226951 - 227020
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgtttatccctttg |
240 |
Q |
| |
|
|||||||| || | ||||||||||||| |||||||| ||||||| ||||||||||||||||| |||||| |
|
|
| T |
226951 |
ttgaggagtaaagccgacaacgacgaagctctatcggtttattttctttactatgttgtttattcctttg |
227020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0381 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0381
Description:
Target: scaffold0381; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 188 - 233
Target Start/End: Complemental strand, 5890 - 5845
Alignment:
| Q |
188 |
caacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5890 |
caacgacggaactctatcgatttattttctttactatgttgtttat |
5845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 231
Target Start/End: Complemental strand, 22233154 - 22233094
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgttt |
231 |
Q |
| |
|
||||||||||||| ||| | ||| |||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
22233154 |
ttgaggagcaacgccgatatcgatgaaactctatcggtttattttttttattatgttgttt |
22233094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 231
Target Start/End: Original strand, 22253585 - 22253645
Alignment:
| Q |
171 |
ttgaggagcaacgtcgacaacgacgaaactctatcgatttatttcttttactatgttgttt |
231 |
Q |
| |
|
||||||||||||| ||| | ||| |||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
22253585 |
ttgaggagcaacgccgatatcgatgaaactctatcggtttattttttttattatgttgttt |
22253645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 44196244 - 44196279
Alignment:
| Q |
1 |
agttgttaaaaagtggatgcacatatatcatttctc |
36 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44196244 |
agttgttaaaaagtggatgtacatatatcatttctc |
44196279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 24267683 - 24267719
Alignment:
| Q |
1 |
agttgttaaaaagtggatgcacatatatcatttctct |
37 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
24267683 |
agttgtcaaaaagtggatgtacatatatcatttctct |
24267719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 24611879 - 24611844
Alignment:
| Q |
1 |
agttgttaaaaagtggatgcacatatatcatttctc |
36 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24611879 |
agttgttaaaaagtggatgtacatatatcatttctc |
24611844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 37
Target Start/End: Original strand, 24910172 - 24910206
Alignment:
| Q |
3 |
ttgttaaaaagtggatgcacatatatcatttctct |
37 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24910172 |
ttgttaaaaagtggatgtacatatatcatttctct |
24910206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 5975583 - 5975546
Alignment:
| Q |
1 |
agttgttaaaaagtggatgcacatatatcatttctcta |
38 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
5975583 |
agttgtcaaaaagtggatgtacatatatcatttctcta |
5975546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 233
Target Start/End: Original strand, 49715985 - 49716030
Alignment:
| Q |
188 |
caacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
|||||||| |||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
49715985 |
caacgacggaactctatcggtttattttctttactatgttgtttat |
49716030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 233
Target Start/End: Original strand, 49719468 - 49719513
Alignment:
| Q |
188 |
caacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
|||||||| |||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
49719468 |
caacgacggaactctatcggtttattttctttactatgttgtttat |
49719513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0214 (Bit Score: 30; Significance: 0.00000008; HSPs: 3)
Name: scaffold0214
Description:
Target: scaffold0214; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 233
Target Start/End: Original strand, 13222 - 13267
Alignment:
| Q |
188 |
caacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
|||||||||| |||||||| ||||||| ||||||||||||||||| |
|
|
| T |
13222 |
caacgacgaagctctatcggtttattttctttactatgttgtttat |
13267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0214; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 233
Target Start/End: Original strand, 27238 - 27283
Alignment:
| Q |
188 |
caacgacgaaactctatcgatttatttcttttactatgttgtttat |
233 |
Q |
| |
|
|||||||||| |||||||| ||||||| ||||||||||||||||| |
|
|
| T |
27238 |
caacgacgaagctctatcggtttattttctttactatgttgtttat |
27283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0214; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 232
Target Start/End: Original strand, 19672 - 19716
Alignment:
| Q |
188 |
caacgacgaaactctatcgatttatttcttttactatgttgttta |
232 |
Q |
| |
|
|||||||||| |||||||| ||||||| |||||||||||||||| |
|
|
| T |
19672 |
caacgacgaagctctatcggtttattttctttactatgttgttta |
19716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University