View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19757_low_104 (Length: 240)

Name: NF19757_low_104
Description: NF19757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19757_low_104
NF19757_low_104
[»] chr4 (1 HSPs)
chr4 (1-97)||(26934747-26934843)


Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 26934843 - 26934747
Alignment:
1 aatactcaattgcaatataaataatcttattgcaatggaaacaatattaagataacttattttgatattatttgtcaaaattatttgactttagtat 97  Q
    ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
26934843 aatactcaattgcaatagaaataatcttattgcaatggaaataatattaagataatttattttgatcttatttgtcaaaattatttgactttagtat 26934747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University