View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19757_low_109 (Length: 237)
Name: NF19757_low_109
Description: NF19757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19757_low_109 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 32965194 - 32964974
Alignment:
| Q |
1 |
aagggccattttcaactcaagatcaaaatccatcaagtgaaaatcttattagtggtgatgaagattttgttgtgattgaattgagtaacaataatgctat |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| | || |||||||| ||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32965194 |
aagggccattttcatctcaagatcaaaatccaactagagaaaatctcattggtggtgatgaagattttgttgtcattgaattgagtaacaataatgctat |
32965095 |
T |
|
| Q |
101 |
ggagtcaccattaccattaccaagaccatgtcctattagtccttcaccaaggaaaatgttggataagaaaggaaggaaaaagttgcataaagtgacaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32965094 |
ggagtcaccattaccattaccaagaccatgtcctattagtccttcaccaaggaaaatgttggataagaaaggaaggaaaaagttgcataaagtgacaagt |
32964995 |
T |
|
| Q |
201 |
atgggagatgaatgtattgat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32964994 |
atgggagatgaatgtattgat |
32964974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University