View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19757_low_112 (Length: 228)
Name: NF19757_low_112
Description: NF19757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19757_low_112 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 18 - 123
Target Start/End: Complemental strand, 11610564 - 11610459
Alignment:
| Q |
18 |
aaaagttaccaacccacgagaggggaatcttgcatataagtttatggttgaccttaacaaaaaatgatatgactatgggaaatattagaccctacttatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| ||||||||| |||||||||||||||| |||| |
|
|
| T |
11610564 |
aaaagttaccaacccacgagaggggaatcttgcatataagtttacggttgaccctaacaaaaaatgatgtgactatggtaaatattagaccctacgtatt |
11610465 |
T |
 |
| Q |
118 |
tcattt |
123 |
Q |
| |
|
||||| |
|
|
| T |
11610464 |
ccattt |
11610459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 147 - 196
Target Start/End: Complemental strand, 11610237 - 11610188
Alignment:
| Q |
147 |
ttaaggagagaatgacactaatattggctaatttaattatgacttataaa |
196 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
11610237 |
ttaaggagagaacgacgctaacattggctaatttaattatgacttataaa |
11610188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University