View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19757_low_114 (Length: 223)
Name: NF19757_low_114
Description: NF19757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19757_low_114 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 16 - 207
Target Start/End: Complemental strand, 7023175 - 7022984
Alignment:
| Q |
16 |
aagaaaatgatggtaagaaaatttagtgttgtgtgaatgatccaatgaagagttagacattggcctctaccctttatatatcaatggagggatagaaata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
7023175 |
aagaaaatgatggtaagaaaatttagtgttgtgtgaatgatccaatgaagagttagacattggcctctaccctttatataccaatggagggatagaaaaa |
7023076 |
T |
 |
| Q |
116 |
tgtgcttgttgctagtgctagctgttgctttcagagcataatagtgggacaaactgttgaaaaatcttggaacatttttaggtaattaattt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7023075 |
tgtgcttgttgctagtgctagctgttgctttcagagcataatagtgggacaaactgttgaaaaatcttggaacatttttaggtaattaattt |
7022984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University