View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19757_low_115 (Length: 223)
Name: NF19757_low_115
Description: NF19757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19757_low_115 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 14 - 206
Target Start/End: Original strand, 47351765 - 47351957
Alignment:
| Q |
14 |
agaagaactttcttagattattagagtgttaatcaataagagctgataattggaacacatgatttagtattttaaaccatactcctgctctctagattcg |
113 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47351765 |
agaagaactttcttagattattagagagttaatcaataagagcttataattggaacacatgatttagtattttaaaccatactcctgctttctagattcc |
47351864 |
T |
|
| Q |
114 |
ttatattcatccggctttgagtttttaatctgatatgaaaaagtctaatggcgtcacaaattactgtgaagtgattgctttgcaagcttctgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47351865 |
ttatattcatccggctttgagtttttaatctgatatgaaaaagtctaatggcgtcacaaattactgtgaagtgattgcttggcaagcttctgt |
47351957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University