View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19757_low_119 (Length: 213)
Name: NF19757_low_119
Description: NF19757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19757_low_119 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 27946326 - 27946530
Alignment:
| Q |
1 |
ttccaaaattcattgatcagtttgtacttatcagattttgatgctagttgttgttaaggtcattgtaaaatggacttctttgatacccgttttaattgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27946326 |
ttccaaaattcattgatcagtttgtacttatctgattttgatgctagttgttgttaaggtcattgtaaaatggacttctttgatacccgttttaattgag |
27946425 |
T |
|
| Q |
101 |
tcaaattgtacagcagatacaagtattttctaattggtcagaggatgagataaaggctagccaagactgataagaggaatg-catcaaagaatatatgat |
199 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27946426 |
tcaaatggtacagcagatacaagtattttctaatttgtgagaggatgagataaaggctagccaagactgataagaggaatgccatcaaagaatatatgat |
27946525 |
T |
|
| Q |
200 |
gatgt |
204 |
Q |
| |
|
||||| |
|
|
| T |
27946526 |
gatgt |
27946530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 27437963 - 27438020
Alignment:
| Q |
1 |
ttccaaaattcattgatcagtttgtacttatcagattttgatgctagttgttgttaag |
58 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27437963 |
ttccaaaatttattgatcagtttgtacttatcagattttgatgctagttgtggttaag |
27438020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 27548424 - 27548386
Alignment:
| Q |
1 |
ttccaaaattcattgatcagtttgtacttatcagatttt |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27548424 |
ttccaaaattcattgatcagtttgtacttatcagatttt |
27548386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University