View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19757_low_32 (Length: 434)
Name: NF19757_low_32
Description: NF19757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19757_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 21 - 426
Target Start/End: Original strand, 7750855 - 7751260
Alignment:
| Q |
21 |
aggttatttaggctgaggtcgaggtgcaaaaggttggttaacttcgcgagggatgaagggatttcaccagacacatggggtaaagcggagaattggagaa |
120 |
Q |
| |
|
||||| ||||||||||||||||| || | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7750855 |
aggttgtttaggctgaggtcgagatggacaaggttggataacttcgcgagggatgaagggatttcaccagacacatggggtaaagcggagaattggagaa |
7750954 |
T |
|
| Q |
121 |
cttgaagaaatgggagatttcctaccgaggatgggaattcgttgttgatgtcatccgcattaatgactacaagcgaattgacacggccattcgtgtcaca |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
7750955 |
cttgaagaaatgggagatttcctaccgaggatggaaattcgttgttgatgtcatccgcattaatgactataagcgaattgacacgaccattcgtgtcaca |
7751054 |
T |
|
| Q |
221 |
cgtgatgcctgtccagttctggcagcagttcgtgttaggatcccaggtggtaaagacggaagcattgtttccaaaatgggatttgatctctaggagaaca |
320 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7751055 |
cgcgatgcctgtccagttctggcagcagttcgtgttaggatcccacgtggtaaagacggaagcattgtttccgaaatgggatttgatctctaggagaaca |
7751154 |
T |
|
| Q |
321 |
tttttgtcgttgtggttgcatgcttgagcagatatagagaggttcaaataagagagacaaataaacaatgtgaatatgaaagagagaacatgggattttg |
420 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7751155 |
tttttgtcattatggttgcatgcttgagcagatataaagaggttcaaataagagagacaaataaacaatgtgaatatgaaagagagaacatgggattttg |
7751254 |
T |
|
| Q |
421 |
atgatg |
426 |
Q |
| |
|
||||| |
|
|
| T |
7751255 |
gtgatg |
7751260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University