View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19757_low_42 (Length: 400)
Name: NF19757_low_42
Description: NF19757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19757_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 10 - 387
Target Start/End: Complemental strand, 47712741 - 47712364
Alignment:
| Q |
10 |
attatacttatagggttcgtgatcgtttgaggaaggatgtgttggtgccgttgaggaaggttttggagttgcctgaggtgtttattggggctaatcgatg |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47712741 |
attatgcttatagggttcgtgatcgtttgaggaaggatgtgttggtgccattgaggaaggttttggagttgcctgaggtgtttattggggctaatcgatg |
47712642 |
T |
|
| Q |
110 |
gaaattgattccttacaacagggttgcgtctgtggcgatggagttttataaagagaagtttttgaagcatgataaaaagaggtttgagaagtatttggag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47712641 |
gaaattgattccttacaacagggttgcgtctgtggcgatggagttttataaagagaagtttttgaagcatgataaaaagaggtttgagaagtatttggag |
47712542 |
T |
|
| Q |
210 |
gatgtgaaagtggggaagactacgatcgctgctggtgctttgcttcctcatgacattattcggtcgttgggggatggagatggtggagaggtggcggagt |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47712541 |
gatgtgaaagtggggaagactacgatcgctgctggtgctttgcttcctcatgatattattcggtcgttgggggatggagatggtggagaggtggcggagt |
47712442 |
T |
|
| Q |
310 |
tacagtggacgagaatggtggatgatttgctcaagaaagggaagatgaggaattgtcttgctgtgtgtgatgtttctg |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47712441 |
tacagtggacgagaatggtggatgatttgctcaagaaagggaagatgaggaattgtcttgctgtgtgtgatgtttctg |
47712364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 10 - 387
Target Start/End: Complemental strand, 19795842 - 19795465
Alignment:
| Q |
10 |
attatacttatagggttcgtgatcgtttgaggaaggatgtgttggtgccgttgaggaaggttttggagttgcctgaggtgtttattggggctaatcgatg |
109 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
19795842 |
attatgcttatagggttcgtgatcggttgaggaaagatgtgttggtgccgttgaggaaggtgttggagttgcctgaggtgtttattggtgctaatcaatg |
19795743 |
T |
|
| Q |
110 |
gaaattgattccttacaacagggttgcgtctgtggcgatggagttttataaagagaagtttttgaagcatgataaaaagaggtttgagaagtatttggag |
209 |
Q |
| |
|
| |||||||| ||||| |||||||| |||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
19795742 |
gggtttgattccatacaatagggttgcttctgtggcgatgaagttttataaggagaagtttttgaagcatgataaggagaggtttgagaagtacttggag |
19795643 |
T |
|
| Q |
210 |
gatgtgaaagtggggaagactacgatcgctgctggtgctttgcttcctcatgacattattcggtcgttgggggatggagatggtggagaggtggcggagt |
309 |
Q |
| |
|
|||||||| | ||||||||||| || ||||||||||||||||||||||| || ||||| ||| |||| |||| |||||||||||| ||||| |||| |
|
|
| T |
19795642 |
gatgtgaaggcagggaagactactattgctgctggtgctttgcttcctcacgagattatagagtctttggatgatgaagatggtggagaagtggctgagt |
19795543 |
T |
|
| Q |
310 |
tacagtggacgagaatggtggatgatttgctcaagaaagggaagatgaggaattgtcttgctgtgtgtgatgtttctg |
387 |
Q |
| |
|
| ||||||| |||||| || ||||||||||||||||| || || ||||||||||||||||||||||||||||| |||| |
|
|
| T |
19795542 |
tgcagtggaagagaattgttgatgatttgctcaagaagggaaaaatgaggaattgtcttgctgtgtgtgatgtgtctg |
19795465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 10 - 387
Target Start/End: Original strand, 19785745 - 19786122
Alignment:
| Q |
10 |
attatacttatagggttcgtgatcgtttgaggaaggatgtgttggtgccgttgaggaaggttttggagttgcctgaggtgtttattggggctaatcgatg |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
19785745 |
attatgcttatagggttcgtgatcgtttgaggaaagatgtgttggtgccgttgaggaaggtgttggagttgcctgaggtgtttattggtgctaatcaatg |
19785844 |
T |
|
| Q |
110 |
gaaattgattccttacaacagggttgcgtctgtggcgatggagttttataaagagaagtttttgaagcatgataaaaagaggtttgagaagtatttggag |
209 |
Q |
| |
|
| |||||||||||||| || ||||| |||||||||||| |||||||||| || |||||||||||||||||||| |||||||||||||||| ||| || |
|
|
| T |
19785845 |
gggtttgattccttacaatagagttgcttctgtggcgatgaagttttataaggaaaagtttttgaagcatgataaggagaggtttgagaagtacttgaag |
19785944 |
T |
|
| Q |
210 |
gatgtgaaagtggggaagactacgatcgctgctggtgctttgcttcctcatgacattattcggtcgttgggggatggagatggtggagaggtggcggagt |
309 |
Q |
| |
|
|||||||| | || |||||||| || ||||||||||||||||||||||| | ||||| ||| ||||||||||||||||||||||| || || |||| |
|
|
| T |
19785945 |
gatgtgaaggcaggaaagactactattgctgctggtgctttgcttcctcaccagattatagagtctttgggggatggagatggtggagaagttgctgagt |
19786044 |
T |
|
| Q |
310 |
tacagtggacgagaatggtggatgatttgctcaagaaagggaagatgaggaattgtcttgctgtgtgtgatgtttctg |
387 |
Q |
| |
|
| ||||||| |||||| || |||||||||||||||||||| ||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
19786045 |
tgcagtggaagagaattgttgatgatttgctcaagaaaggaaagatgaaaaattgtcttgcagtgtgtgatgtttctg |
19786122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 182; Significance: 3e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 10 - 387
Target Start/End: Complemental strand, 15835149 - 15834772
Alignment:
| Q |
10 |
attatacttatagggttcgtgatcgtttgaggaaggatgtgttggtgccgttgaggaaggttttggagttgcctgaggtgtttattggggctaatcgatg |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||||| ||| |
|
|
| T |
15835149 |
attatgcttatagggttcgtgatcgtttgaggaaagatgtgttggtgccgttgaggaaggcgttgcaattgcctgaggtgtttattggggctaatcaatg |
15835050 |
T |
|
| Q |
110 |
gaaattgattccttacaacagggttgcgtctgtggcgatggagttttataaagagaagtttttgaagcatgataaaaagaggtttgagaagtatttggag |
209 |
Q |
| |
|
| ||||||||||| || |||||||| |||||||| |||||||||||||| ||||||||||||||||||||| | |||||||||||||||| ||| || |
|
|
| T |
15835049 |
gggtttgattccttataatagggttgcttctgtggccatggagttttataaggagaagtttttgaagcatgatgaggagaggtttgagaagtacttgcag |
15834950 |
T |
|
| Q |
210 |
gatgtgaaagtggggaagactacgatcgctgctggtgctttgcttcctcatgacattattcggtcgttgggggatggagatggtggagaggtggcggagt |
309 |
Q |
| |
|
|||||||| | ||||||||||| || |||||||||||||||||||||||| | ||||| ||| || | ||||| |||||||||| |||| |||| |
|
|
| T |
15834949 |
gatgtgaaggcagggaagactactatggctgctggtgctttgcttcctcataagattataaagtcttttttgaatggatatggtggagaagtggatgagt |
15834850 |
T |
|
| Q |
310 |
tacagtggacgagaatggtggatgatttgctcaagaaagggaagatgaggaattgtcttgctgtgtgtgatgtttctg |
387 |
Q |
| |
|
| ||||||| |||||| || |||||||||||||||||||| ||||||| ||||||||||| |||| |||||| |||| |
|
|
| T |
15834849 |
tgcagtggaagagaattgttgatgatttgctcaagaaaggaaagatgaaaaattgtcttgcagtgtctgatgtgtctg |
15834772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University