View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19757_low_65 (Length: 338)
Name: NF19757_low_65
Description: NF19757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19757_low_65 |
 |  |
|
| [»] scaffold0057 (4 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0954 (1 HSPs) |
 |  |  |
|
| [»] scaffold1176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
| [»] scaffold0167 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0867 (1 HSPs) |
 |  |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 318; Significance: 1e-179; HSPs: 91)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 326
Target Start/End: Original strand, 25628963 - 25629288
Alignment:
| Q |
1 |
caaatcgttcttaaacccaagtttgtctctttccttccatgaactagtccaaagaaagaattgaatgagaactacgattattatggtatactacactcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25628963 |
caaatcgttcttaaacccaagtttgtctctttccttccatgaactagtccaaagaaagaattgaatgagaactacgattattatggtatactacactcac |
25629062 |
T |
 |
| Q |
101 |
acccatctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25629063 |
acccatctggaaacagtctcttgtgtaaaaaatagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctacatatgcgggagct |
25629162 |
T |
 |
| Q |
201 |
ttagtgcaccgggttgccctttttactacactcacacccatccaattagccagagtcatccacactttacaaaagttgactcttgcgacccacatcctcc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25629163 |
ttagtgcaccgggttgccctttttactacactcacacccatccaattagccagagtcatccacactttacaaaagttgactcttgcgacccacatcctcc |
25629262 |
T |
 |
| Q |
301 |
tacacagttccgcacatcttcgccta |
326 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
25629263 |
tacacagttccgcacatcttcgccta |
25629288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 20639774 - 20639656
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| ||| ||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20639774 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagt |
20639675 |
T |
 |
| Q |
206 |
gcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
20639674 |
gcaccgggttgcccttttt |
20639656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 16408718 - 16408599
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||| |||||||||||||| ||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16408718 |
ctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaataatggtggaaccccttcccggaccccgcatatgcgggagctttag |
16408619 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
16408618 |
tgcaccgggttgcccttttt |
16408599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 30639400 - 30639516
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30639400 |
ctggaaacagactcttgtgtaaaaac-agggtaaggctgcgtacaatacaccaaatggtgagaccccttcccggaccctgcatatgcgggagctttagtg |
30639498 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
30639499 |
cactgggttgcccttttt |
30639516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 47443977 - 47444094
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||| |||||||| |||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
47443977 |
ctggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcaggagcttcagtg |
47444076 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
47444077 |
cactgggttgcccttttt |
47444094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 107 - 225
Target Start/End: Original strand, 5648279 - 5648396
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
5648279 |
ctggaaacagcctcttgtgtaaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtg |
5648377 |
T |
 |
| Q |
207 |
caccgggttgcccttttta |
225 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
5648378 |
cactgggttgcccttttta |
5648396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 111 - 224
Target Start/End: Complemental strand, 11054257 - 11054146
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| |||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11054257 |
aaacagtctcttgtgtaaaaca--gggtaagactgcgtacaatacaccaaatggcggaaccccttcccggaccctgcatatgcgggagctctagtgcacc |
11054160 |
T |
 |
| Q |
211 |
gggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
11054159 |
gggttgcccttttt |
11054146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 113 - 224
Target Start/End: Original strand, 23501813 - 23501926
Alignment:
| Q |
113 |
acagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
|||| ||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23501813 |
acagcctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
23501912 |
T |
 |
| Q |
211 |
gggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
23501913 |
gggttgcccttttt |
23501926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 107 - 222
Target Start/End: Original strand, 20225004 - 20225117
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| ||||||||||||| | ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20225004 |
ctggaaacaacctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
20225101 |
T |
 |
| Q |
207 |
caccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
20225102 |
caccgggttgcccttt |
20225117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 108 - 224
Target Start/End: Original strand, 35567191 - 35567307
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||||| | ||||||||||||| |||||||| |||||||||| |||||||||||||||||||||||||| ||||||| | ||||||||||||||||| |
|
|
| T |
35567191 |
tggaaacagccacttgtgtaaaaaacagggtaaggctgtgtacaacacaccaaatggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgc |
35567290 |
T |
 |
| Q |
208 |
accgggttgcccttttt |
224 |
Q |
| |
|
|||||| |||||||||| |
|
|
| T |
35567291 |
accgggctgcccttttt |
35567307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 107 - 219
Target Start/End: Original strand, 21646984 - 21647098
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||| |||||||| ||||| |||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
21646984 |
ctggaaacagcctcttgtgtaaaaaatagggtaaggctgcgtacaatataccaataatggtgggaccccttcccagaccccgcatatgcgggagctttag |
21647083 |
T |
 |
| Q |
205 |
tgcaccgggttgccc |
219 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
21647084 |
tgcaccgggttgccc |
21647098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 47528643 - 47528528
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||| ||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||| |
|
|
| T |
47528643 |
ctggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgaatatgtgggagctctagtg |
47528546 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
47528545 |
caccgggttgcccttttt |
47528528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 48598938 - 48598823
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||| ||| ||||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||| |
|
|
| T |
48598938 |
ctggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccatgcatatgccggagctctagtg |
48598841 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
48598840 |
caccgggttgcccttttt |
48598823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 108 - 221
Target Start/End: Complemental strand, 6430739 - 6430627
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| ||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| || |
|
|
| T |
6430739 |
tggaaacagcctcttgtgtaaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccacttcccggaccctgcgtatgcgggagctttagcgc |
6430641 |
T |
 |
| Q |
208 |
accgggttgccctt |
221 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6430640 |
accgggttgccctt |
6430627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 111 - 225
Target Start/End: Complemental strand, 9832422 - 9832310
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
|||||| ||||||||||||| | ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| || ||||||||| |
|
|
| T |
9832422 |
aaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcaggaactctagtgcacc |
9832325 |
T |
 |
| Q |
211 |
gggttgcccttttta |
225 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
9832324 |
gggttgcccttttta |
9832310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 129 - 220
Target Start/End: Complemental strand, 29207991 - 29207900
Alignment:
| Q |
129 |
aaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccct |
220 |
Q |
| |
|
|||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29207991 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
29207900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 110 - 223
Target Start/End: Original strand, 14983857 - 14983970
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
209 |
Q |
| |
|
||||||| |||||||||||||||||||||||| || |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
14983857 |
gaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtac |
14983956 |
T |
 |
| Q |
210 |
cgggttgccctttt |
223 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
14983957 |
catgttgccctttt |
14983970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 111 - 223
Target Start/End: Complemental strand, 51865149 - 51865037
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
|||||| ||||||||||||||| | |||||| ||| |||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
51865149 |
aaacagcctcttgtgtaaaaaacatggtaaggctgcgtacaatacaccaaatggtggggccccttcccggaccctgcgtatgcgggagctttattgcacc |
51865050 |
T |
 |
| Q |
211 |
gggttgccctttt |
223 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
51865049 |
ggactgccctttt |
51865037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 111 - 225
Target Start/End: Original strand, 54175088 - 54175203
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttccc-ggaccctgcatatgcgggagctttagtgca |
208 |
Q |
| |
|
|||||| |||||||||||||| |||||||| ||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54175088 |
aaacagcctcttgtgtaaaaac-agggtaaggctgcgtacaatacaccaaaatggtgggaccccttccccggaccctgcatatgcgggagctttagtgca |
54175186 |
T |
 |
| Q |
209 |
ccgggttgcccttttta |
225 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
54175187 |
ccgggctgcccttttta |
54175203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 107 - 221
Target Start/End: Complemental strand, 7909395 - 7909281
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgc-gggagctttagt |
205 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||||||| |
|
|
| T |
7909395 |
ctggaaacagtctcttgtgtaaaaac-agggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcggggagctttagt |
7909297 |
T |
 |
| Q |
206 |
gcaccgggttgccctt |
221 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
7909296 |
gcatcgggttgccctt |
7909281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 118 - 225
Target Start/End: Complemental strand, 13256505 - 13256396
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggtt |
215 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||| || |||||||||||||||| |||| |||| ||||||||||||||||||||||||| |
|
|
| T |
13256505 |
ctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggtt |
13256406 |
T |
 |
| Q |
216 |
gcccttttta |
225 |
Q |
| |
|
|||||||||| |
|
|
| T |
13256405 |
gcccttttta |
13256396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 107 - 221
Target Start/End: Original strand, 40915849 - 40915962
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||||||||||| ||| |||| ||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
40915849 |
ctggaaacagcctcttgtgtaaaaacaagg-taaggctgcgtacaatacaccaaatggtgggagcccttcccggaccctgcgtatgcgggagcttcagtg |
40915947 |
T |
 |
| Q |
207 |
caccgggttgccctt |
221 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
40915948 |
caccggattgccctt |
40915962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 9987949 - 9987832
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| ||| |||||||||||||||||||||||||||||| |||| ||||||||||||||||||| || |
|
|
| T |
9987949 |
ctggaaacaacctcttgtgtaaacaatagggtaaggctgcatacaatacaccaaatggtgggaccccttccttgaccttgcatatgcgggagctttaatg |
9987850 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
||||||| |||| ||||| |
|
|
| T |
9987849 |
caccgggctgcctttttt |
9987832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 17043509 - 17043393
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | |||||||| ||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| || |
|
|
| T |
17043509 |
ctggaaacagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccagaccctgcatatgctggagcttta-tg |
17043411 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||| || ||||| |||| |
|
|
| T |
17043410 |
caccaggctgcccctttt |
17043393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 151 - 224
Target Start/End: Original strand, 38786673 - 38786746
Alignment:
| Q |
151 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38786673 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
38786746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 134 - 222
Target Start/End: Original strand, 20225121 - 20225211
Alignment:
| Q |
134 |
agggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||| ||| |||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20225121 |
agggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
20225211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 111 - 222
Target Start/End: Complemental strand, 44363243 - 44363130
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttagtgca |
208 |
Q |
| |
|
|||||| ||| ||||||||||| |||||| | ||| |||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44363243 |
aaacagcctcgtgtgtaaaaaacagggtagggctgcgtacaacgcaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca |
44363144 |
T |
 |
| Q |
209 |
ccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
44363143 |
ccgggttgcccttt |
44363130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 108 - 204
Target Start/End: Complemental strand, 39029175 - 39029078
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| ||||||||||||||| ||| |||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
39029175 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacacgaaaatggtgggaccactttccggaccctgcatatgcgggagctttag |
39029078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 5306778 - 5306658
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatg----cgggagcttt |
202 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||| || ||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
5306778 |
ctggaaacagcctcttgtgtaaaatc-agggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgtggacgggagcttt |
5306680 |
T |
 |
| Q |
203 |
agtgcaccgggttgcccttttt |
224 |
Q |
| |
|
| |||||||||||||||||||| |
|
|
| T |
5306679 |
aatgcaccgggttgcccttttt |
5306658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 110 - 223
Target Start/End: Original strand, 16911585 - 16911700
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||| |||||||||| ||| |||||||| ||| |||||||||||||| ||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
16911585 |
gaaacagcctcttgtgtacaaatcagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtacgcgggagctttagttt |
16911684 |
T |
 |
| Q |
208 |
accgggttgccctttt |
223 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
16911685 |
accgggttgccctttt |
16911700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 110 - 222
Target Start/End: Original strand, 20405109 - 20405224
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||| || ||||||||||| || |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20405109 |
gaaacagcctcttgtgtaaaaaaacagggtaagattgcgtacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtg |
20405208 |
T |
 |
| Q |
207 |
caccgggttgcccttt |
222 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
20405209 |
cattgggttgcccttt |
20405224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 126 - 222
Target Start/End: Complemental strand, 30690272 - 30690176
Alignment:
| Q |
126 |
taaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
||||||| |||||||| ||| ||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||| |
|
|
| T |
30690272 |
taaaaaacagggtaaggctgcatacaatacaccaattggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgcccttt |
30690176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 107 - 217
Target Start/End: Original strand, 21489107 - 21489218
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||||||| |||||| |||||||| || ||||||||| ||||||| ||||||| |||||||||||||||||| ||||||| |||||||||||||| || |
|
|
| T |
21489107 |
ctggaaacagcctcttgcgtaaaaaacagagtaagactgcgtacaatgcaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttcgt |
21489206 |
T |
 |
| Q |
206 |
gcaccgggttgc |
217 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
21489207 |
gcactgggttgc |
21489218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 161 - 224
Target Start/End: Original strand, 32484307 - 32484370
Alignment:
| Q |
161 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32484307 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
32484370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 107 - 225
Target Start/End: Original strand, 25463142 - 25463259
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| ||||||||||||||| ||| ||| || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25463142 |
ctggaaacaacctcttgtgtaaaaaactgggaaaggttgcgtacaacacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt-gtg |
25463240 |
T |
 |
| Q |
207 |
caccgggttgcccttttta |
225 |
Q |
| |
|
|||| || | ||||||||| |
|
|
| T |
25463241 |
caccaggctacccttttta |
25463259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 134 - 221
Target Start/End: Complemental strand, 8473710 - 8473621
Alignment:
| Q |
134 |
agggtaagactgtgtacaatacaccaaatggtgggaccccttccc-ggaccc-tgcatatgcgggagctttagtgcaccgggttgccctt |
221 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8473710 |
agggtaaggctgcatacaatacaccaaatggtgggaccccttccccggacccctgcatatgcgggagctttagtgcaccgggttgccctt |
8473621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 107 - 199
Target Start/End: Complemental strand, 7385591 - 7385499
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagc |
199 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
7385591 |
ctggaaacagcctcatgtgtaaaaaatagggtaaggttgtgtgcaatacaccaaatggtgggaccctttcccggaccctgtgtatgcgggagc |
7385499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 148 - 224
Target Start/End: Complemental strand, 33836563 - 33836485
Alignment:
| Q |
148 |
tacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33836563 |
tacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgcccttttt |
33836485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 114 - 222
Target Start/End: Complemental strand, 48327873 - 48327763
Alignment:
| Q |
114 |
cagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg |
211 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||| ||||||| |||| ||||||||| || |||||||||||| |
|
|
| T |
48327873 |
cagtctcttgtgtaaaaaacagggtaagactgcatacaatacaccaataatggtgggacctcttcccgaaccccacatatgcggaagttttagtgcaccg |
48327774 |
T |
 |
| Q |
212 |
ggttgcccttt |
222 |
Q |
| |
|
|||| |||||| |
|
|
| T |
48327773 |
ggttacccttt |
48327763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 110 - 223
Target Start/End: Original strand, 7038075 - 7038188
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgca |
208 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||||||| |||||||||| | ||| |||||||||||| ||| | |||||||||||||| |
|
|
| T |
7038075 |
gaaacagcttcttgtgtaaaaaatagggtaagacttcgtacaatacaccaaaatggtggggcacctacccggaccctgcgtatac-ggagctttagtgca |
7038173 |
T |
 |
| Q |
209 |
ccgggttgccctttt |
223 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
7038174 |
ctgggttgccctttt |
7038188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 160 - 222
Target Start/End: Complemental strand, 38755970 - 38755908
Alignment:
| Q |
160 |
aatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38755970 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
38755908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 39077909 - 39077794
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||| || |||||||| ||||||||||| ||| ||| |||||||||||||||||||||||| ||||| |
|
|
| T |
39077909 |
ctggaaacagcctcttgtgtaaaaca--gggtaaggttgcgtacaatataccaaatggtgagacatctttccggaccctgcatatgcgggagctctagtg |
39077812 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
39077811 |
caccgggttgcctttttt |
39077794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 110 - 212
Target Start/End: Complemental strand, 47441642 - 47441540
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
209 |
Q |
| |
|
||||||||||||| |||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||||| || || |||||||| || ||| |
|
|
| T |
47441642 |
gaaacagtctcttttgtaaaaatcagggtaaggctgtgtacaatacaccaaatggttggaccccttcccggaccctgagtaagcaggagctttcgtccac |
47441543 |
T |
 |
| Q |
210 |
cgg |
212 |
Q |
| |
|
||| |
|
|
| T |
47441542 |
cgg |
47441540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 124 - 225
Target Start/End: Complemental strand, 10277855 - 10277754
Alignment:
| Q |
124 |
tgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||| |||||||| |||| ||| |||||||||||||||||||| |||||||||| ||||||||||||||||||| | ||||| ||||| |||||||||| |
|
|
| T |
10277855 |
tgtataaaataggataaggctgcgtacaatacaccaaatggtgaaaccccttcccagaccctgcatatgcgggagttctagtgaaccggattgccctttt |
10277756 |
T |
 |
| Q |
224 |
ta |
225 |
Q |
| |
|
|| |
|
|
| T |
10277755 |
ta |
10277754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 119 - 212
Target Start/End: Original strand, 19027880 - 19027973
Alignment:
| Q |
119 |
tcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg |
212 |
Q |
| |
|
|||||||||||||| |||||||| ||| |||||||||||||| |||||||||||||| || ||| |||| |||| ||||||||||||||||||| |
|
|
| T |
19027880 |
tcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaattggtgggacccctttccagactctgcgtatgtgggagctttagtgcaccgg |
19027973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 158 - 222
Target Start/End: Original strand, 11394923 - 11394987
Alignment:
| Q |
158 |
caaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11394923 |
caaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
11394987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 158 - 222
Target Start/End: Original strand, 11404650 - 11404714
Alignment:
| Q |
158 |
caaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11404650 |
caaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
11404714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 147 - 224
Target Start/End: Complemental strand, 30352657 - 30352578
Alignment:
| Q |
147 |
gtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30352657 |
gtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgcccttttt |
30352578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 108 - 206
Target Start/End: Complemental strand, 30581581 - 30581481
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30581581 |
tggaaacaacctcttgtgtaaaaaaacagggtaagggtgtgtacaatacaccaaaatggtgggaccccttcccggaccctgcatatgtaggagctttagt |
30581482 |
T |
 |
| Q |
206 |
g |
206 |
Q |
| |
|
| |
|
|
| T |
30581481 |
g |
30581481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 126 - 224
Target Start/End: Complemental strand, 20908733 - 20908634
Alignment:
| Q |
126 |
taaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||| | |||||| ||| ||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||| || |||||||||| |
|
|
| T |
20908733 |
taaaaaagaaggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacaaggctgcccttttt |
20908634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 107 - 201
Target Start/End: Original strand, 49796818 - 49796911
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctt |
201 |
Q |
| |
|
|||||||||| ||||||||| |||| | |||||| ||| ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
49796818 |
ctggaaacagcctcttgtgttaaaac-atggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctt |
49796911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 110 - 224
Target Start/End: Original strand, 54730272 - 54730389
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaa-tagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||| ||||||||||||||| |||| |||| ||| ||| |||||||||| ||| ||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54730272 |
gaaacagcctcttgtgtaaaaaaataggataaggctgcgtataatacaccaataatgatggaaccccttcccggaccctgcgtatgcgggagctttagtg |
54730371 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
||||| || |||||||| |
|
|
| T |
54730372 |
caccgaattacccttttt |
54730389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 107 - 208
Target Start/End: Original strand, 37494871 - 37494972
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| || ||||||| |||||||||||||||||||| | ||||||||| ||||| |||||||||||| |
|
|
| T |
37494871 |
ctggaaacaacctcttgtgtaaaaaacagggtaaggttgcatacaatataccaaatggtgggacccctttcgggaccctgcgtatgcaggagctttagtg |
37494970 |
T |
 |
| Q |
207 |
ca |
208 |
Q |
| |
|
|| |
|
|
| T |
37494971 |
ca |
37494972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 161 - 222
Target Start/End: Complemental strand, 40553998 - 40553937
Alignment:
| Q |
161 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40553998 |
atggtgtgaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
40553937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 118 - 219
Target Start/End: Original strand, 54967052 - 54967151
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgc |
217 |
Q |
| |
|
||||||||||||||| |||||||| || ||||||| |||||||||||||||||||||||| ||||| |||||||||||||||| |||||||||| ||| |
|
|
| T |
54967052 |
ctcttgtgtaaaaaacagggtaaggttgc-tacaatataccaaatggtgggaccccttcccgtaccctacatatgcgggagcttt-gtgcaccgggctgc |
54967149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 118 - 202
Target Start/End: Complemental strand, 3580944 - 3580860
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt |
202 |
Q |
| |
|
|||||||||||||| | |||||| |||||| |||||||||||||| | |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3580944 |
ctcttgtgtaaaaaccatggtaaggctgtgtgcaatacaccaaatgctaggaccccttcccggaccctgcatatgtgggagcttt |
3580860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 119 - 221
Target Start/End: Complemental strand, 12711553 - 12711450
Alignment:
| Q |
119 |
tcttgtgtaaaaaa-tagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgc |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||| ||||||||||| | |||| || ||||||| | |||||||||||| ||||| |
|
|
| T |
12711553 |
tcttgtgtaaaaaaatagggtaagactgcgtacaatacaccaaatggcgggaccccttctcagacctagcgtatgcggaaactttagtgcacccagttgc |
12711454 |
T |
 |
| Q |
218 |
cctt |
221 |
Q |
| |
|
|||| |
|
|
| T |
12711453 |
cctt |
12711450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 151 - 222
Target Start/End: Complemental strand, 32478862 - 32478792
Alignment:
| Q |
151 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||| ||||||| |
|
|
| T |
32478862 |
aatacaccaaatggtgggaccccttcccggacccagcgtatgcgggagcttt-gtgcaccgggtggcccttt |
32478792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 160 - 222
Target Start/End: Original strand, 25388249 - 25388311
Alignment:
| Q |
160 |
aatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
25388249 |
aatggtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttgcccttt |
25388311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 108 - 222
Target Start/End: Complemental strand, 55766579 - 55766466
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||| ||| ||||||||||| |||||||| ||||| ||||||||| ||| |||||| |||||||||||| |
|
|
| T |
55766579 |
tggaaacagtttcttgtgtgtaaac-agggtaaggctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgc |
55766481 |
T |
 |
| Q |
208 |
accgggttgcccttt |
222 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
55766480 |
accgggatgcccttt |
55766466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 172 - 224
Target Start/End: Original strand, 35532077 - 35532129
Alignment:
| Q |
172 |
ccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35532077 |
ccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
35532129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 107 - 204
Target Start/End: Complemental strand, 49938705 - 49938611
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49938705 |
ctggaaacagcctcttgtgtaaaaacg-gggtaag---gtgtacaatacaccaaaatggtgggaccccttcccataccctgcatatgcgggagctttag |
49938611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 158 - 224
Target Start/End: Original strand, 28494222 - 28494288
Alignment:
| Q |
158 |
caaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||| |||||||||||| |||| ||||| |
|
|
| T |
28494222 |
caaatggtgggaccccttcccagatcctgcatatgcgggagctctagtgcaccgggctgcctttttt |
28494288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 147 - 224
Target Start/End: Complemental strand, 36816460 - 36816382
Alignment:
| Q |
147 |
gtacaatacaccaaat-ggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||||| |||||||| |||||| |||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36816460 |
gtacaatacaccaaaaaggtgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgcccttttt |
36816382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 108 - 222
Target Start/End: Complemental strand, 55830834 - 55830721
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||||||||||||||| ||| ||||||| ||| ||||||||||| |||||||| ||||| ||||||||| ||| |||||| |||||||||||| |
|
|
| T |
55830834 |
tggaaacagtctcttgtgtgtaaac-agggtaatgctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgc |
55830736 |
T |
 |
| Q |
208 |
accgggttgcccttt |
222 |
Q |
| |
|
||| || |||||||| |
|
|
| T |
55830735 |
accaggatgcccttt |
55830721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 171 - 225
Target Start/End: Original strand, 56322984 - 56323038
Alignment:
| Q |
171 |
cccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttta |
225 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56322984 |
cccttcccggaccccggatatgcgggagctttagtgcaccgggttgcccttttta |
56323038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 106 - 224
Target Start/End: Original strand, 25343206 - 25343326
Alignment:
| Q |
106 |
tctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcgggagcttta |
203 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||| ||| |||||||||||| ||| ||| ||||||||||| || ||||| |||| | |||||||| |
|
|
| T |
25343206 |
tctggaaatagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaagggttggaccccttcctagatcctgcgtatgtgagagcttta |
25343305 |
T |
 |
| Q |
204 |
gtgcaccgggttgcccttttt |
224 |
Q |
| |
|
| ||||| || ||||| |||| |
|
|
| T |
25343306 |
gagcacccggctgcccctttt |
25343326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 107 - 219
Target Start/End: Original strand, 36589763 - 36589876
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||||||| ||||||||||||||| | ||||| |||| ||| ||||||||| |||||||||||||||| | ||||| |||||||||||||| || |
|
|
| T |
36589763 |
ctggaaacagcctcttgtgtaaaaaacatggtaatgctgttgacagtacaccaaaatggtgggaccccttcctgaaccctatgtatgcgggagctttggt |
36589862 |
T |
 |
| Q |
206 |
gcaccgggttgccc |
219 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
36589863 |
gcaccgggctgccc |
36589876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 161 - 222
Target Start/End: Original strand, 44718641 - 44718702
Alignment:
| Q |
161 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
44718641 |
atggtgggaccccttcccagaccctgcgtatgcgggagctttagcacaccgggttgcccttt |
44718702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 108 - 211
Target Start/End: Complemental strand, 30496434 - 30496333
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||||| |||||||||||| | ||||||| ||| ||||||||||||||||| ||||| |||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
30496434 |
tggaaacagcctcttgtgtaaacac--gggtaaggctgcatacaatacaccaaatggggggactccttcccggaccgtgcttatgatggagctttagtgc |
30496337 |
T |
 |
| Q |
208 |
accg |
211 |
Q |
| |
|
|||| |
|
|
| T |
30496336 |
accg |
30496333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 159 - 223
Target Start/End: Complemental strand, 47482913 - 47482849
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||||| || | ||||||||| |
|
|
| T |
47482913 |
aaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcaacgagctgccctttt |
47482849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 160 - 224
Target Start/End: Complemental strand, 50555718 - 50555654
Alignment:
| Q |
160 |
aatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||| |||| |||||||||||||| |||||||||| |
|
|
| T |
50555718 |
aatggtggaaccccttcccggaccctgcgtatgcaggagttttagtgcaccgggctgcccttttt |
50555654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 224
Target Start/End: Original strand, 19027986 - 19028048
Alignment:
| Q |
162 |
tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||| ||||||||||||| | ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19027986 |
tggtgggactccttcccggaccccacttatgcgggagctttagtgcaccgggctgcccttttt |
19028048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 107 - 209
Target Start/End: Complemental strand, 41018908 - 41018807
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||| || |||||||||||||||| ||||||||||||||| |||| ||| |||| || ||||||||| |
|
|
| T |
41018908 |
ctggaaacaacctcttgtgtaaaat-tagggtaaggctacgtacaatacaccaaatagtgggaccccttcccagaccttgcgtatggaggggctttagtg |
41018810 |
T |
 |
| Q |
207 |
cac |
209 |
Q |
| |
|
||| |
|
|
| T |
41018809 |
cac |
41018807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 10660424 - 10660543
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagcttt-a |
203 |
Q |
| |
|
||||||||| ||||| |||||||||||||||| | ||| |||||||||||| ||||||| |||||||||| || ||||| |||||||||||||| | |
|
|
| T |
10660424 |
ctggaaacaacctcttatgtaaaaaatagggtatggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagctttaa |
10660522 |
T |
 |
| Q |
204 |
gtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||| |||||||||| |||| |
|
|
| T |
10660523 |
gtgcatcgggttgcccctttt |
10660543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 10874569 - 10874688
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagcttt-a |
203 |
Q |
| |
|
||||||||| ||||| |||||||||||||||| | ||| |||||||||||| ||||||| |||||||||| || ||||| |||||||||||||| | |
|
|
| T |
10874569 |
ctggaaacaacctcttatgtaaaaaatagggtatggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagctttaa |
10874667 |
T |
 |
| Q |
204 |
gtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||| |||||||||| |||| |
|
|
| T |
10874668 |
gtgcatcgggttgcccctttt |
10874688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 134 - 222
Target Start/End: Original strand, 2813172 - 2813263
Alignment:
| Q |
134 |
agggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagcttt-agtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||| |||||||||| ||| |||||||||||| |||||| || ||| |||||||||||||| |||||||||| ||||||||| |
|
|
| T |
2813172 |
agggtaagactgcgtacaatacatcaataatggtgggaccctttcccgaacgatgcgtatgcgggagctttaagtgcaccggattgcccttt |
2813263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 118 - 224
Target Start/End: Complemental strand, 23580312 - 23580206
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttg |
216 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||| |||||||||| ||| | ||||||||| ||||| || |||| |||||||||||||||||| | || |
|
|
| T |
23580312 |
ctcttgtgtaaaaaacaggggaagactgcgtaggatacaccaaaatggcgagaccccttcttggacc-tgtgtatgtgggagctttagtgcaccgagctg |
23580214 |
T |
 |
| Q |
217 |
cccttttt |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
23580213 |
cccttttt |
23580206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 117 - 175
Target Start/End: Original strand, 9037760 - 9037818
Alignment:
| Q |
117 |
tctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggacccctt |
175 |
Q |
| |
|
||||||||| | ||||||||||||||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
9037760 |
tctcttgtgcataaaatagggtaagactgcatacaatacaccgaatggtaggacccctt |
9037818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 121 - 181
Target Start/End: Complemental strand, 35894563 - 35894502
Alignment:
| Q |
121 |
ttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccgga |
181 |
Q |
| |
|
|||||||||||| | |||||| || ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35894563 |
ttgtgtaaaaaacacggtaagtgtgcgtacaatacaccaaaatggtgggaccccttcccgga |
35894502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 487187 - 487135
Alignment:
| Q |
161 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggg |
213 |
Q |
| |
|
|||| |||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
487187 |
atggcgggaccccttcccggattctgcgaatgcgggagctttagtgcaccggg |
487135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 160 - 208
Target Start/End: Original strand, 8820581 - 8820629
Alignment:
| Q |
160 |
aatggtgggaccccttcccggaccctgcatatgcgggagctttagtgca |
208 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||| ||| ||||||||| |
|
|
| T |
8820581 |
aatggtgggaccccttcccagaccctgcgtatgcgagagttttagtgca |
8820629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 221
Target Start/End: Complemental strand, 12666914 - 12666858
Alignment:
| Q |
165 |
tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt |
221 |
Q |
| |
|
||||||||||| |||||| ||| ||||| ||||||||||| ||||||||||||||| |
|
|
| T |
12666914 |
tgggaccccttgtcggaccatgcgtatgcaggagctttagtacaccgggttgccctt |
12666858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 16494278 - 16494345
Alignment:
| Q |
148 |
tacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggg |
213 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| ||||||| ||||||| |||||||||| |||||| |
|
|
| T |
16494278 |
tacaatacaccaaaaatggtgggaccctttcccagaccctgtgtatgcggaagctttagtgtaccggg |
16494345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 143 - 224
Target Start/End: Original strand, 48033380 - 48033463
Alignment:
| Q |
143 |
ctgtgtacaatacaccaaa-tggtggg-accccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||| ||||||||||| ||||||| ||||||| ||||| ||| |||||||||||||||||||||| | ||||| ||||| |
|
|
| T |
48033380 |
ctgtgtataatacaccaaaatggtggggacccctttgtggaccttgcgtatgcgggagctttagtgcacctgattgcctttttt |
48033463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 108 - 182
Target Start/End: Complemental strand, 17079765 - 17079691
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggac |
182 |
Q |
| |
|
|||||||| | ||||||||| |||| |||||||| ||| |||||||| | |||||||||||||| |||| |||| |
|
|
| T |
17079765 |
tggaaacaatatcttgtgtataaaacagggtaaggctgcatacaatacgctaaatggtgggaccctttcctggac |
17079691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 173 - 210
Target Start/End: Complemental strand, 37038172 - 37038135
Alignment:
| Q |
173 |
cttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
37038172 |
cttcccgtaccctgcgtatgcgggagctttagtgcacc |
37038135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 221
Target Start/End: Original strand, 21003410 - 21003469
Alignment:
| Q |
161 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt |
221 |
Q |
| |
|
|||||| |||| |||||| |||||||| | |||||||||||| |||||||||| ||||||| |
|
|
| T |
21003410 |
atggtgtgacctcttcccagaccctgcgtgtgcgggagcttt-gtgcaccgggctgccctt |
21003469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 170 - 222
Target Start/End: Complemental strand, 34257034 - 34256982
Alignment:
| Q |
170 |
ccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
||||||| | |||| |||| |||||||||||||||||||||||| ||| |||| |
|
|
| T |
34257034 |
ccccttctcagaccttgcacatgcgggagctttagtgcaccgggctgctcttt |
34256982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 128 - 199
Target Start/End: Original strand, 46082784 - 46082856
Alignment:
| Q |
128 |
aaaaatagggtaagactgtgtacaatacacca-aatggtgggaccccttcccggaccctgcatatgcgggagc |
199 |
Q |
| |
|
||||||||| |||| ||| ||| |||||| | ||||||| ||| ||||| |||||||||||||||||||||| |
|
|
| T |
46082784 |
aaaaataggttaaggctgcgtattatacacaataatggtgagactccttctcggaccctgcatatgcgggagc |
46082856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 210
Target Start/End: Original strand, 51420662 - 51420706
Alignment:
| Q |
166 |
gggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
||||||||||| |||||| |||||||| |||||||||||||||| |
|
|
| T |
51420662 |
gggaccccttctcggaccatgcatatgtaggagctttagtgcacc |
51420706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 97; Significance: 1e-47; HSPs: 91)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 108 - 224
Target Start/End: Complemental strand, 46248067 - 46247951
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46248067 |
tggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgt |
46247968 |
T |
 |
| Q |
208 |
accgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
46247967 |
accgggttgcccttttt |
46247951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 46991847 - 46991964
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| |||||||||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
46991847 |
ctggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtg |
46991946 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
46991947 |
caccgggttgcccatttt |
46991964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 30395843 - 30395725
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| ||| |||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30395843 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttag |
30395744 |
T |
 |
| Q |
205 |
tgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
30395743 |
tgcaccgagttgccctttt |
30395725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 125 - 222
Target Start/End: Original strand, 4349699 - 4349796
Alignment:
| Q |
125 |
gtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||| |||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4349699 |
gtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
4349796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 18944686 - 18944806
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagc-ttta |
203 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| ||| |||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
18944686 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaacaatggtgggaccccttcccggaccctgcgtatgcgggagctttta |
18944785 |
T |
 |
| Q |
204 |
gtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
18944786 |
gtgcaccgggttgcccttttt |
18944806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 34725211 - 34725097
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||| ||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34725211 |
ctggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacactaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
34725114 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
34725113 |
caccgggttgccctttt |
34725097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 107 - 223
Target Start/End: Original strand, 14617081 - 14617197
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||||||||| || | |||||| || ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14617081 |
ctggaaacagcctcttgtgtaaataacaaggtaaggttgcgtacaatacaccaaatggtgggatcccttcccggaccctgcatatgcgggagctttagtg |
14617180 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
||||||||| ||||||| |
|
|
| T |
14617181 |
caccgggttaccctttt |
14617197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 110 - 225
Target Start/End: Complemental strand, 35253297 - 35253184
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
209 |
Q |
| |
|
||||||| ||||||||||||| | ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35253297 |
gaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
35253200 |
T |
 |
| Q |
210 |
cgggttgcccttttta |
225 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
35253199 |
cggattgcccttttta |
35253184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 41319921 - 41319805
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||| ||||||||||||||||| ||||||||||||||| ||||| |||||||||||| || |||| |
|
|
| T |
41319921 |
ctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatgatgggaccccttcccgaacccttcatatgcgggagtttcagtg |
41319822 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
41319821 |
cactgggttgccctttt |
41319805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 6925143 - 6925260
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||| || |||||||||||||||||||||||| ||| | |||||||||| ||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
6925143 |
ctggaaatagcctcttgtgtaaaaaatagggtaaggctgcggacaatacaccgaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtg |
6925242 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
||||| |||||| ||||| |
|
|
| T |
6925243 |
caccgagttgcctttttt |
6925260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 31382328 - 31382212
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||||||||||| ||| |||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
31382328 |
ctggaaacagcctcttgtgtaaaaac-aggataaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcatatgcgggagctttactg |
31382230 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
31382229 |
taccgggttgcccttttt |
31382212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 107 - 223
Target Start/End: Original strand, 10668268 - 10668386
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||||||||||| | |||||| || |||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
10668268 |
ctggaaacagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggtccctgcgtatgcgggagctttag |
10668367 |
T |
 |
| Q |
205 |
tgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
10668368 |
tgcaccgggttgccctttt |
10668386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 20004207 - 20004089
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| |||| |||||||||| | |||||| ||| |||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
20004207 |
ctggaaacagcctctcgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttag |
20004108 |
T |
 |
| Q |
205 |
tgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
20004107 |
tgcaccgggttgccctttt |
20004089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 111 - 223
Target Start/End: Original strand, 35005170 - 35005284
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttagtgca |
208 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||| |||||||||||||| |||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
35005170 |
aaacagcctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggcgctttagtgca |
35005269 |
T |
 |
| Q |
209 |
ccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
35005270 |
ccgggttgccctttt |
35005284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 110 - 224
Target Start/End: Complemental strand, 38478392 - 38478280
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
209 |
Q |
| |
|
||||||| ||||||||||||| | ||||||| ||| ||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
38478392 |
gaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtggaaccccttctcggaccctgcatatgcgggagctctagtgcac |
38478295 |
T |
 |
| Q |
210 |
cgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
38478294 |
cgggttgcccttttt |
38478280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 108 - 217
Target Start/End: Complemental strand, 23768434 - 23768325
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| ||| |||||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
23768434 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggacaccttcccagaccctgcgtatgcgggagctttagtgc |
23768335 |
T |
 |
| Q |
208 |
accgggttgc |
217 |
Q |
| |
|
| ||| |||| |
|
|
| T |
23768334 |
agcggattgc |
23768325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 32632671 - 32632556
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
32632671 |
ctggaaacagcctcttgtgtaaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagcttgagtg |
32632573 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
|||| |||| ||||||| |
|
|
| T |
32632572 |
caccaggtttccctttt |
32632556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 107 - 202
Target Start/End: Complemental strand, 18724660 - 18724565
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt |
202 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| |||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18724660 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaaatcttgggaccccttcccggaccctacatatgcgggagcttt |
18724565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 108 - 223
Target Start/End: Original strand, 27474325 - 27474439
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
|||||||||||||||||||||||| |||| || ||| ||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27474325 |
tggaaacagtctcttgtgtaaaaac-agggcaaagctgcgtacaatacactgaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgc |
27474423 |
T |
 |
| Q |
208 |
accgggttgccctttt |
223 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
27474424 |
accggattgccctttt |
27474439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 106 - 223
Target Start/End: Complemental strand, 12126951 - 12126836
Alignment:
| Q |
106 |
tctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||||| |||||||||||| | ||||||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12126951 |
tctggaaacagcttcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaattgtgggaccccttcccggaccctgcatatgcgggagctgtagt |
12126854 |
T |
 |
| Q |
206 |
gcaccgggttgccctttt |
223 |
Q |
| |
|
|||| | ||||||||||| |
|
|
| T |
12126853 |
gcactgcgttgccctttt |
12126836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 129 - 223
Target Start/End: Original strand, 19414502 - 19414596
Alignment:
| Q |
129 |
aaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||| ||| |||| ||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19414502 |
aaaacaggttaaggctgcgtacaatacaccaaatggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
19414596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 111 - 224
Target Start/End: Complemental strand, 45812646 - 45812535
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
45812646 |
aaacagtctcttgtgtaaaaga--gggtaaggctgcatacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcacc |
45812549 |
T |
 |
| Q |
211 |
gggttgcccttttt |
224 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
45812548 |
gggttgcctttttt |
45812535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 23796508 - 23796625
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||||||||||| | ||||| || |||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
23796508 |
ctggaaacagcctcttgtgtaaaaatcaatgtaaggttgcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgctggagctttagtg |
23796607 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
23796608 |
caccgggctgcccttttt |
23796625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 27201690 - 27201809
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||||| | ||| |||||||| ||| ||||||||||||||| |||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
27201690 |
ctggaaacagcctcttgtgtcagaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccttgcgtatgcgggagctttag |
27201789 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||| |||||||||||||| |
|
|
| T |
27201790 |
tgcattgggttgcccttttt |
27201809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 129 - 219
Target Start/End: Complemental strand, 10378828 - 10378738
Alignment:
| Q |
129 |
aaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccc |
219 |
Q |
| |
|
|||| |||||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10378828 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgggctgccc |
10378738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 47214554 - 47214669
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||||||||||| ||||| | ||||||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
47214554 |
ctggaaacagtctcttgtttaaaaca--gggtaaggttgcgtacaatacaccaaatggtgggaccccttcccagaccctgcatatgcgggagctctagtg |
47214651 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||| | || |||||||| |
|
|
| T |
47214652 |
caccagattacccttttt |
47214669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 147 - 224
Target Start/End: Original strand, 45402179 - 45402256
Alignment:
| Q |
147 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45402179 |
gtacaatacaccaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgcccgtttt |
45402256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 159 - 224
Target Start/End: Original strand, 50606498 - 50606563
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50606498 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
50606563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 109 - 225
Target Start/End: Complemental strand, 18742073 - 18741954
Alignment:
| Q |
109 |
ggaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||||| |||| ||||||| |||||||| ||| ||||||||||||||| ||||||||||||||||| |||||||| |||||| |||||||||| |
|
|
| T |
18742073 |
ggaaacagtcttttgtataaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagt |
18741974 |
T |
 |
| Q |
206 |
gcaccgggttgcccttttta |
225 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
18741973 |
gcaccgggtttcccttttta |
18741954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 118 - 202
Target Start/End: Complemental strand, 20169193 - 20169109
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt |
202 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20169193 |
ctcttgtgtaaaaaaaaaggtaagactgtgtacaataccccaatcggtgggactccttcccggaccctgcatatgcgggagcttt |
20169109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 107 - 210
Target Start/End: Complemental strand, 45264515 - 45264411
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||| |||||||| |||||| || ||||| |||||| |||||||||||| ||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
45264515 |
ctggaaacaacctcttgtgcaaaaaacagagtaaggctgtgtgcaatacaccaaaatggtgggaccccttctcagaccctgcatatgcgggagctttagt |
45264416 |
T |
 |
| Q |
206 |
gcacc |
210 |
Q |
| |
|
||||| |
|
|
| T |
45264415 |
gcacc |
45264411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 118 - 224
Target Start/End: Complemental strand, 1517416 - 1517309
Alignment:
| Q |
118 |
ctcttgtgt-aaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttg |
216 |
Q |
| |
|
||||||||| |||||| | | |||| ||| |||||||||||||| ||||||||||||||| | |||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
1517416 |
ctcttgtgttaaaaaacatgataaggctgcgtacaatacaccaattggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttg |
1517317 |
T |
 |
| Q |
217 |
cccttttt |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
1517316 |
cccttttt |
1517309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 107 - 222
Target Start/End: Complemental strand, 35117883 - 35117765
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacc--aaatggtgggaccccttcccggaccctgcat-atgcgggagcttta |
203 |
Q |
| |
|
||||||| || ||||||||||||| | |||||||| |||||||||||||||| ||||| ||||||||||||||||||||||| | |||| ||||||||| |
|
|
| T |
35117883 |
ctggaaatagcctcttgtgtaaaatacagggtaaggctgtgtacaatacaccaaaaatgatgggaccccttcccggaccctgcgtaatgcaggagcttta |
35117784 |
T |
 |
| Q |
204 |
gtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||| | |||||| |
|
|
| T |
35117783 |
gtgcaccgggcttcccttt |
35117765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 107 - 212
Target Start/End: Complemental strand, 2435902 - 2435796
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||||||| ||| ||||| |||||||||||||| ||| |||||||||||| ||||||||||||||||| ||| ||||| | |||||||||||||||| |
|
|
| T |
2435902 |
ctggaaacagcctcctgtgtgaaaaatagggtaagcctgcgtacaatacaccaaaatggtgggacccctttccgtaccctccgcatgcgggagctttagt |
2435803 |
T |
 |
| Q |
206 |
gcaccgg |
212 |
Q |
| |
|
||||||| |
|
|
| T |
2435802 |
gcaccgg |
2435796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 118 - 224
Target Start/End: Original strand, 8197097 - 8197203
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgc |
217 |
Q |
| |
|
||||||||||||||| | |||||| || ||||| ||||||||||||| |||||||||| |||||||||| |||| |||||||||||| |||||||||| |
|
|
| T |
8197097 |
ctcttgtgtaaaaaacatggtaaggctacgtacagtacaccaaatggtaggaccccttctcggaccctgcgtatgttggagctttagtgtaccgggttgc |
8197196 |
T |
 |
| Q |
218 |
ccttttt |
224 |
Q |
| |
|
||||||| |
|
|
| T |
8197197 |
ccttttt |
8197203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 111 - 224
Target Start/End: Original strand, 19701617 - 19701731
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
209 |
Q |
| |
|
|||||| ||||||||||||||| |||||| || ||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19701617 |
aaacagcctcttgtgtaaaaaacttggtaaggatgggtacaatacaccaaaatggtggggccccttcccggaccctgcgtatgcgggagctttagtgcac |
19701716 |
T |
 |
| Q |
210 |
cgggttgcccttttt |
224 |
Q |
| |
|
| || | |||||||| |
|
|
| T |
19701717 |
caggctacccttttt |
19701731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 126 - 223
Target Start/End: Complemental strand, 6983907 - 6983810
Alignment:
| Q |
126 |
taaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||| |||||||| || ||||||||||||||||||||||||||||| ||||||||||| || || |||||||| |||||||||| ||||||||| |
|
|
| T |
6983907 |
taaaaaacagggtaagtatgcgtacaatacaccaaatggtgggacccctttccggaccctgcgtaggcaggagctttggtgcaccgggctgccctttt |
6983810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 134 - 211
Target Start/End: Original strand, 15505634 - 15505710
Alignment:
| Q |
134 |
agggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||||| |
|
|
| T |
15505634 |
agggtaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagcttt-gtgcaccg |
15505710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 120 - 223
Target Start/End: Complemental strand, 20999952 - 20999849
Alignment:
| Q |
120 |
cttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccc |
219 |
Q |
| |
|
||||||||||||| | || ||| ||| ||||||||||||||||| |||| |||||||| | ||||||| || |||||||||||||||||||||| ||||| |
|
|
| T |
20999952 |
cttgtgtaaaaaacaaggcaaggctgcgtacaatacaccaaatgatggggccccttccggcaccctgcgtacgcgggagctttagtgcaccgggctgccc |
20999853 |
T |
 |
| Q |
220 |
tttt |
223 |
Q |
| |
|
|||| |
|
|
| T |
20999852 |
tttt |
20999849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 128 - 224
Target Start/End: Complemental strand, 42304303 - 42304205
Alignment:
| Q |
128 |
aaaaatagggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||| |||||||| || ||||||||||| ||| |||||||||||||||||||||||||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
42304303 |
aaaaacagggtaaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgcccttttt |
42304205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 155 - 217
Target Start/End: Complemental strand, 4587630 - 4587568
Alignment:
| Q |
155 |
caccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
4587630 |
caccaaatggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccgggttgc |
4587568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 121 - 220
Target Start/End: Complemental strand, 19932856 - 19932755
Alignment:
| Q |
121 |
ttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcc |
218 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||||||||||| |||||||||||||||||||||||||| ||||| || | |||||||||| ||||||| |
|
|
| T |
19932856 |
ttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcaccaggttgcc |
19932757 |
T |
 |
| Q |
219 |
ct |
220 |
Q |
| |
|
|| |
|
|
| T |
19932756 |
ct |
19932755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 107 - 213
Target Start/End: Complemental strand, 34149075 - 34148969
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||| || |||||| | ||||||||||| |||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
34149075 |
ctggaaacagcctcttgtgtagaaaatagggtaaggttgcgtacaaaagaccaaatggtgagaccccttcctggaccctgcatatgcaggagcgctagtg |
34148976 |
T |
 |
| Q |
207 |
caccggg |
213 |
Q |
| |
|
|| |||| |
|
|
| T |
34148975 |
caacggg |
34148969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 134 - 224
Target Start/End: Original strand, 43768209 - 43768299
Alignment:
| Q |
134 |
agggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||| ||| ||||||||||||| ||||||||||||||||| |||||||| ||| ||||||||||| ||||||||| |||||||||| |
|
|
| T |
43768209 |
agggtaaggctgcctacaatacaccaattggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgcccttttt |
43768299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 107 - 220
Target Start/End: Complemental strand, 15511266 - 15511150
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtg--tacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagcttta |
203 |
Q |
| |
|
|||||||| | ||||||||||||||| |||||||| ||| | |||||||||||||| |||||| ||||||||| ||||||||| |||| | |||||||| |
|
|
| T |
15511266 |
ctggaaaccgcctcttgtgtaaaaaacagggtaaggctgcggatacaatacaccaaaatggtggtaccccttcctggaccctgcgtatgtgtgagcttta |
15511167 |
T |
 |
| Q |
204 |
gtgcaccgggttgccct |
220 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
15511166 |
gtgcaccgggctgccct |
15511150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 118 - 202
Target Start/End: Original strand, 11596567 - 11596650
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt |
202 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||| ||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11596567 |
ctcttgtgtaaaaac-agggtaaggctgcgtataatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttt |
11596650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 108 - 223
Target Start/End: Complemental strand, 19656220 - 19656104
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| ||||||||||||||| | ||||| || |||||||||||||||| |||| |||||| ||| ||||||||||||||| |||||||| || |
|
|
| T |
19656220 |
tggaaacagcctcttgtgtaaaaaacatggtaacgctatgtacaatacaccaaaatggtaggaccctttcttggaccctgcatatgcaagagctttaatg |
19656121 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
||||||| ||||||||| |
|
|
| T |
19656120 |
caccgggctgccctttt |
19656104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 107 - 225
Target Start/End: Original strand, 20036263 - 20036381
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaa-atagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||| |||||||||||| | | ||||||||| || || |||||||||||||||||| ||||||||||||||||||| ||||| |||| ||| || |
|
|
| T |
20036263 |
ctggaaacaaactcttgtgtaaagagaaagggtaagattgcgttcaatacaccaaatggtggaaccccttcccggaccctgcgtatgcaggag-ttttgt |
20036361 |
T |
 |
| Q |
206 |
gcaccgggttgcccttttta |
225 |
Q |
| |
|
|||||||| ||| ||||||| |
|
|
| T |
20036362 |
gcaccgggctgctcttttta |
20036381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 107 - 213
Target Start/End: Complemental strand, 44485224 - 44485119
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| | ||||||||||| | | |||||| ||| ||||||||||||||||||| ||||||||||||||| ||| | |||||||||||||| ||| |
|
|
| T |
44485224 |
ctggaaacaaccacttgtgtaaaagacatggtaaggctgcgtacaatacaccaaatggttggaccccttcccggatcctacgtatgcgggagcttt-gtg |
44485126 |
T |
 |
| Q |
207 |
caccggg |
213 |
Q |
| |
|
||||||| |
|
|
| T |
44485125 |
caccggg |
44485119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 107 - 200
Target Start/End: Complemental strand, 25468378 - 25468285
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
200 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| || ||||||||||||||||||| ||||| |||||| |||||||| |||||||||||| |
|
|
| T |
25468378 |
ctggaaacaacctcttgtgtaaaaatcagggtaaggttgcgtacaatacaccaaatggttggacctcttcccagaccctgcgtatgcgggagct |
25468285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 107 - 223
Target Start/End: Original strand, 9939504 - 9939623
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa--tggtgggacccc-ttcccggaccctgcatatgcgggagcttta |
203 |
Q |
| |
|
||||||||| ||||||| ||| ||| | |||||| || || |||||||||||| |||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
9939504 |
ctggaaacaacctcttgtttaagaaacatggtaaggttgcgtgcaatacaccaaaaatggtgggacccccttctcggaccctgcgtatgcgggagcttta |
9939603 |
T |
 |
| Q |
204 |
gtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
9939604 |
gtgcaccgggttaccctttt |
9939623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 50811982 - 50812100
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| || |||||||||||| ||||||| ||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
50811982 |
ctggaaacagcttcttgtgtaaaaaaacagggtaaggttgcgtacaatacaccaaaatggt-ggaccccttcccgcgccctgcgtatgcgggagctttaa |
50812080 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||| ||| |||||||||| |
|
|
| T |
50812081 |
tgcactgggctgcccttttt |
50812100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 4430137 - 4430080
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtggg |
168 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
4430137 |
aaacagtatcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtggg |
4430080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 159 - 224
Target Start/End: Original strand, 30555210 - 30555275
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||| |||||||||||||||||| || ||||||| |
|
|
| T |
30555210 |
aaatggtgggaccccttcacggaccctgcgtatgcgagagctttagtgcaccgggctgaccttttt |
30555275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 127 - 215
Target Start/End: Complemental strand, 31442485 - 31442396
Alignment:
| Q |
127 |
aaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggtt |
215 |
Q |
| |
|
|||||| |||||||| || ||||||||||||||| ||||||||||||||||||||| ||| |||| ||||||||| |||||||||||| |
|
|
| T |
31442485 |
aaaaaacagggtaaggatgcgtacaatacaccaaaatggtgggaccccttcccggacactgtgtatgtgggagctttggtgcaccgggtt |
31442396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 107 - 219
Target Start/End: Complemental strand, 39215074 - 39214961
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||| ||| |||||||| ||||| ||||||| ||||||||| ||||||| |||| || ||||||||| |
|
|
| T |
39215074 |
ctggaaacaacctcttgtgtaaaaaactgggtaaggctgcgtacaatattccaaaatggtgggtccccttcccaaaccctgcgtatgtggaagctttagt |
39214975 |
T |
 |
| Q |
206 |
gcaccgggttgccc |
219 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
39214974 |
gcaccgggctgccc |
39214961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 118 - 202
Target Start/End: Original strand, 30682868 - 30682950
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt |
202 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||| |||| |||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
30682868 |
ctcttgtgtaaaaacaagg-taagattgtgtaca-tacaacaaatggtgggaccccttcccggaccgtgcgtatgcgggagcttt |
30682950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 148 - 224
Target Start/End: Original strand, 35019314 - 35019389
Alignment:
| Q |
148 |
tacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||| ||||||||||||| ||| |||||||| |||||| |||||||||||||||||| |||| ||||| |
|
|
| T |
35019314 |
tacaatacaccaattggtgggacccct-cccagaccctgcgtatgcgagagctttagtgcaccgggctgccattttt |
35019389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 108 - 220
Target Start/End: Original strand, 22324937 - 22325049
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| ||| |||||||||||||| |||||| |||| ||||| ||||||| ||||||||||||||||| |
|
|
| T |
22324937 |
tggaaacagcctcttgtgtaaaaac-agggtaaggctgcatacaatacaccaaaaatggtggagccccgtcccg-accctgcgtatgcgggagctttagt |
22325034 |
T |
 |
| Q |
206 |
gcaccgggttgccct |
220 |
Q |
| |
|
||||| || |||||| |
|
|
| T |
22325035 |
gcaccaggctgccct |
22325049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 157 - 223
Target Start/End: Complemental strand, 33594196 - 33594130
Alignment:
| Q |
157 |
ccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||| ||||||||||||||||| |||||||| ||||||||||||||||||||| ||| | ||||||| |
|
|
| T |
33594196 |
ccaattggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcactgggctaccctttt |
33594130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 167 - 224
Target Start/End: Original strand, 16120819 - 16120876
Alignment:
| Q |
167 |
ggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||| || |||||||||| |
|
|
| T |
16120819 |
ggaccccttcccggcccctgcatatgcgggagctttaatgcaccaggctgcccttttt |
16120876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 128 - 185
Target Start/End: Complemental strand, 21910743 - 21910686
Alignment:
| Q |
128 |
aaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccct |
185 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21910743 |
aaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccct |
21910686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 144 - 213
Target Start/End: Original strand, 23371203 - 23371271
Alignment:
| Q |
144 |
tgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggg |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| || |||||||| |||| || ||||||||||||||||| |
|
|
| T |
23371203 |
tgtgtacaatacaccaaatgctgggacccctt-ccagaccctgcgtatgtggtagctttagtgcaccggg |
23371271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 118 - 220
Target Start/End: Complemental strand, 34679323 - 34679217
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggac----cctgcatatgcgggagctttagtgcaccggg |
213 |
Q |
| |
|
||||||||||||||| |||||||||||| |||| ||||| |||||||||| |||| | || ||| ||||| ||||||||||||||||| ||||||| |
|
|
| T |
34679323 |
ctcttgtgtaaaaaacagggtaagactgcgtactatacatcaaatggtggagccccgttccagacccggcctgcgtatgcgggagctttagtacaccggg |
34679224 |
T |
 |
| Q |
214 |
ttgccct |
220 |
Q |
| |
|
|||||| |
|
|
| T |
34679223 |
ctgccct |
34679217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 110 - 208
Target Start/End: Complemental strand, 17470458 - 17470361
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgca |
208 |
Q |
| |
|
||||||| ||||||||||||||| |||||||| ||| |||||||||||| |||| ||||||||| |||| | ||||| |||| ||||||||||||||| |
|
|
| T |
17470458 |
gaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatagtgggacccgttcctg--acctgcgtatgtgggagctttagtgca |
17470361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 128 - 223
Target Start/End: Complemental strand, 19974169 - 19974073
Alignment:
| Q |
128 |
aaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||||||||| ||| || ||||||||||||||| || |||||||| ||||||||| || ||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
19974169 |
aaaaatagggcaaggttgcgtacaatacaccaaaatgatgggacccattcccggactctatgtatgcgggagctttagtgcacggggctgccctttt |
19974073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 108 - 192
Target Start/End: Original strand, 21723728 - 21723811
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatg |
192 |
Q |
| |
|
||||||||| ||||||| ||||| |||||||||| ||| ||||||||||||||||||| | ||| |||||||||||||| |||| |
|
|
| T |
21723728 |
tggaaacagcctcttgtataaaa-atagggtaaggctgagtacaatacaccaaatggtagaaccttttcccggaccctgcgtatg |
21723811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 107 - 187
Target Start/End: Complemental strand, 22930182 - 22930104
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgc |
187 |
Q |
| |
|
|||||||||| || ||||||||||| |||||||| |||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22930182 |
ctggaaacagccttttgtgtaaaaac-agggtaaggttgtg-acaatacaccaaatggtgggaccccttcctggaccctgc |
22930104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 147 - 210
Target Start/End: Complemental strand, 4249518 - 4249455
Alignment:
| Q |
147 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||| || ||||||||||||||| |||||| |
|
|
| T |
4249518 |
gtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttaatgcacc |
4249455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 147 - 210
Target Start/End: Complemental strand, 4249842 - 4249779
Alignment:
| Q |
147 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||| || ||||||||||||||| |||||| |
|
|
| T |
4249842 |
gtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttaatgcacc |
4249779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 147 - 210
Target Start/End: Complemental strand, 4250166 - 4250103
Alignment:
| Q |
147 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||| || ||||||||||||||| |||||| |
|
|
| T |
4250166 |
gtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttaatgcacc |
4250103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 107 - 205
Target Start/End: Complemental strand, 18335403 - 18335305
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| || |||||||||| |||||| |||||||| |||| |||| || ||| ||||||||||||| |
|
|
| T |
18335403 |
ctggaaacagtctcttgtttaaaaattagggtaaagttgcgtacaatacatcaaatgatgggaccctttcctagaccatgtgtatacgggagctttagt |
18335305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 107 - 225
Target Start/End: Original strand, 22327142 - 22327257
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| |||||||| || |||| |||||||||| |||||| || ||| |||||||||||||| || |
|
|
| T |
22327142 |
ctggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtacgatgcaccaaaatggtggg----gttcccgaactctgtgtatgcgggagctttggt |
22327237 |
T |
 |
| Q |
206 |
gcaccgggttgcccttttta |
225 |
Q |
| |
|
|||||||| |||| |||||| |
|
|
| T |
22327238 |
gcaccgggctgcctttttta |
22327257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 134 - 226
Target Start/End: Original strand, 6358191 - 6358284
Alignment:
| Q |
134 |
agggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttttac |
226 |
Q |
| |
|
||||||| ||| |||||| |||||||| ||||||||||||||||| |||||||| ||||| ||| |||||||| | ||| |||||||||||| |
|
|
| T |
6358191 |
agggtaaagctgcgtacaaaacaccaaaatggtgggaccccttcccagaccctgcgtatgcaggatctttagtgatcggggctgccctttttac |
6358284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 108 - 225
Target Start/End: Original strand, 24564388 - 24564495
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||| || ||||||| ||||||||||| ||| ||||||||| ||||| ||||| ||||||| |
|
|
| T |
24564388 |
tggaaacaacctcttgtgtaaaaaacagggtaagggtgcgtacaattcaccaaatggt-------ctt---ggaccctgcctatgcaggagcgttagtgc |
24564477 |
T |
 |
| Q |
208 |
accgggttgcccttttta |
225 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
24564478 |
accgggttgcccttttta |
24564495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 108 - 208
Target Start/End: Original strand, 43207539 - 43207640
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||| ||||| ||| ||||| |||||||||| | |||||||||||||| |||||||||| |||||| |||||| |||||| ||||||||||| |
|
|
| T |
43207539 |
tggaaacaacctcttatgtgaaaaacagggtaagacggcatacaatacaccaaattggtgggacctcttcccagaccctatgtatgcgagagctttagtg |
43207638 |
T |
 |
| Q |
207 |
ca |
208 |
Q |
| |
|
|| |
|
|
| T |
43207639 |
ca |
43207640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 147 - 207
Target Start/End: Complemental strand, 4430074 - 4430014
Alignment:
| Q |
147 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||||||||||||||||| ||||||| | ||| |||| ||||||||||||||||||| |
|
|
| T |
4430074 |
gtacaatacaccaaatggtggaacccctttctggatcctgtgtatgcgggagctttagtgc |
4430014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 127 - 199
Target Start/End: Complemental strand, 20982845 - 20982773
Alignment:
| Q |
127 |
aaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagc |
199 |
Q |
| |
|
||||||||||||||| ||| |||||||||| |||||||||| | |||| |||||||||| ||||||||||| |
|
|
| T |
20982845 |
aaaaaatagggtaaggctgccaacaatacacctaatggtgggatctcttctcggaccctgcgtatgcgggagc |
20982773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 147 - 219
Target Start/End: Complemental strand, 28894633 - 28894561
Alignment:
| Q |
147 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccc |
219 |
Q |
| |
|
|||||||||| |||||||| ||||||||| ||||||||||||||| ||||||||||||||| || ||||| |
|
|
| T |
28894633 |
gtacaatacatcaaatggtaaaaccccttcctagaccctgcatatgcgagagctttagtgcaccaggctgccc |
28894561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 172 - 223
Target Start/End: Complemental strand, 19386626 - 19386575
Alignment:
| Q |
172 |
ccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||| |||||| ||||| |
|
|
| T |
19386626 |
ccttcccggaccctgcatatgcgggagctctagtgaaccaggttgctctttt |
19386575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 118 - 212
Target Start/End: Complemental strand, 27136756 - 27136661
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg |
212 |
Q |
| |
|
||||||||||||||| | |||||| || |||||||||||| ||||||||||||||||||| || | || |||||||||||| |||||||||| |
|
|
| T |
27136756 |
ctcttgtgtaaaaaacatggtaaggttgcgtacaatacaccaaaatggtgggaccccttcctagatcatgtgtatgcgggagctccagtgcaccgg |
27136661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 148 - 208
Target Start/End: Complemental strand, 43921866 - 43921804
Alignment:
| Q |
148 |
tacaatacaccaaatggtgggacccct--tcccggaccctgcatatgcgggagctttagtgca |
208 |
Q |
| |
|
|||||||||||||||||| |||||||| || ||||||||||| ||||| ||||||||||||| |
|
|
| T |
43921866 |
tacaatacaccaaatggtaggacccctattctcggaccctgcacatgcgagagctttagtgca |
43921804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 168 - 222
Target Start/End: Complemental strand, 25554796 - 25554742
Alignment:
| Q |
168 |
gaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| |||||||||||| |||||||| |
|
|
| T |
25554796 |
gaccccttcccgaaccctgcgtatgcgggagcattagtgcaccggactgcccttt |
25554742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 224
Target Start/End: Original strand, 46859129 - 46859227
Alignment:
| Q |
127 |
aaaaaatagggtaagactgtgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||||||| | || | | || ||| |||| ||||| |||||||||||||| | |||||||| |
|
|
| T |
46859129 |
aaaaaacagggtaagactgcgtacaatacaccaaaatggtgggactcattttcaggccttgcgtatgtgggagttttagtgcaccgggcttcccttttt |
46859227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 175 - 225
Target Start/End: Complemental strand, 50760287 - 50760237
Alignment:
| Q |
175 |
tcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttta |
225 |
Q |
| |
|
||||| ||||||| ||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
50760287 |
tcccgaaccctgcgtatgcgggagctttaatgcaccgggctgcccttttta |
50760237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 147 - 210
Target Start/End: Original strand, 7074599 - 7074663
Alignment:
| Q |
147 |
gtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
||||||||||||||| | |||||||| ||| | |||||||||||| |||||||||||||||||| |
|
|
| T |
7074599 |
gtacaatacaccaaaattgtgggacctctttctagaccctgcatatccgggagctttagtgcacc |
7074663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 225
Target Start/End: Complemental strand, 21773676 - 21773636
Alignment:
| Q |
185 |
tgcatatgcgggagctttagtgcaccgggttgcccttttta |
225 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
21773676 |
tgcatatgtgggagctttggtgcaccgggttgcccttttta |
21773636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 177 - 224
Target Start/End: Complemental strand, 31272426 - 31272379
Alignment:
| Q |
177 |
ccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||| |||||||||||||||||| || ||| |||||||||| |
|
|
| T |
31272426 |
ccggaccctgcgtatgcgggagctttagtggactgggctgcccttttt |
31272379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 118 - 172
Target Start/End: Original strand, 10163813 - 10163867
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccc |
172 |
Q |
| |
|
||||| ||||||||||| | ||||| ||| ||||||||| ||||||||||||||| |
|
|
| T |
10163813 |
ctcttatgtaaaaaatatgataagattgtatacaatacatcaaatggtgggaccc |
10163867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 159 - 224
Target Start/End: Complemental strand, 41440665 - 41440600
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||| ||||||||| ||| ||| |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
41440665 |
aaatggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgcccttttt |
41440600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 159 - 210
Target Start/End: Original strand, 1693221 - 1693273
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagc-tttagtgcacc |
210 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| |||| ||||| ||||||||||| |
|
|
| T |
1693221 |
aaatggtgggaccccttcccagacccggcagatgcaggagcttttagtgcacc |
1693273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 94; Significance: 8e-46; HSPs: 4)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 46851 - 46968
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46851 |
ctggaaacaacctcttgtgtaaaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg |
46950 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
46951 |
caccgggttgcccttttt |
46968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 112 - 224
Target Start/End: Complemental strand, 24882 - 24770
Alignment:
| Q |
112 |
aacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg |
211 |
Q |
| |
|
||||| ||||||||||||||| |||||||| ||| |||||| |||||||||||||||||||||||||| ||||||| |||||||||||||||||||| | |
|
|
| T |
24882 |
aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaacacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcagcc |
24783 |
T |
 |
| Q |
212 |
ggttgcccttttt |
224 |
Q |
| |
|
||||||||||||| |
|
|
| T |
24782 |
ggttgcccttttt |
24770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 106 - 223
Target Start/End: Original strand, 43678 - 43794
Alignment:
| Q |
106 |
tctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcc-cggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
||||||||||| |||||||||||| | |||||| ||| ||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||| |
|
|
| T |
43678 |
tctggaaacagcgtcttgtgtaaaacaa--ggtaaggctgcgtacaatacaccaaatggtgggacccctttctcggaccctgcatatgcgggagctctag |
43775 |
T |
 |
| Q |
205 |
tgcaccgggttgccctttt |
223 |
Q |
| |
|
||||| | ||||||||||| |
|
|
| T |
43776 |
tgcactgagttgccctttt |
43794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 46770 - 46721
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgca |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||| |||| |
|
|
| T |
46770 |
aaatggtgggaccccttcccagaccctgcgtatgcgggagctttaatgca |
46721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 94; Significance: 8e-46; HSPs: 65)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 35261699 - 35261816
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
35261699 |
ctggaaacagtctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtg |
35261798 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
35261799 |
caccgggttgcccttttt |
35261816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 107 - 225
Target Start/End: Complemental strand, 28817741 - 28817623
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| ||| |||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28817741 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacccaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg |
28817642 |
T |
 |
| Q |
207 |
caccgggttgcccttttta |
225 |
Q |
| |
|
|| |||||||||||||||| |
|
|
| T |
28817641 |
catcgggttgcccttttta |
28817623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 20869943 - 20870062
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||| |||||||||||||| ||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
20869943 |
ctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagctttag |
20870042 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
20870043 |
tgcaccgggttgcccttttt |
20870062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 107 - 223
Target Start/End: Original strand, 36720816 - 36720932
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
36720816 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtg |
36720915 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
36720916 |
cacccggttgccctttt |
36720932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 107 - 225
Target Start/End: Complemental strand, 5135404 - 5135287
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||| |
|
|
| T |
5135404 |
ctggaaacagcctcttgtgtaaaaaagagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcaggagcttt-gtg |
5135306 |
T |
 |
| Q |
207 |
caccgggttgcccttttta |
225 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
5135305 |
caccgggctgcccttttta |
5135287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 8897879 - 8897762
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| | |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8897879 |
ctggaaacaaccgcttgtgtaaaaaatagggtaaggctacgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttactg |
8897780 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
8897779 |
cacccggttgcccttttt |
8897762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 108 - 223
Target Start/End: Original strand, 44530170 - 44530285
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||| ||| ||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
44530170 |
tggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgc |
44530269 |
T |
 |
| Q |
208 |
accgggttgccctttt |
223 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
44530270 |
accgggttgacctttt |
44530285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 12670363 - 12670248
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12670363 |
ctggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
12670266 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
12670265 |
caccgggttacccttttt |
12670248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 107 - 223
Target Start/End: Original strand, 12625909 - 12626026
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||| |||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
12625909 |
ctggaaacaacctcttgtgtaaaaaaacagggtaagactgcatacaatacaccaaatggtgggaccccctcccggaccctgcgtatgcgggagctttagt |
12626008 |
T |
 |
| Q |
206 |
gcaccgggttgccctttt |
223 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
12626009 |
gcaccgggttgccctttt |
12626026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 6760842 - 6760961
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
6760842 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggcttcgtacaatacaccaataatggtgggaccccttctcggaccccgcatatgcgggagctttag |
6760941 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
6760942 |
tgcaccgggttgcccttttt |
6760961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 107 - 222
Target Start/End: Original strand, 17823596 - 17823711
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||||||||||| ||| |||||||| ||| ||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
17823596 |
ctggaaacagcctcttgtgtaaaaaccaggataagactgcgtaaaatacaccaaatggtggaaccccttcccgaaccctgcatatgcaggagctttagtg |
17823695 |
T |
 |
| Q |
207 |
caccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
17823696 |
caccgggttgcccttt |
17823711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 39461111 - 39460993
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||||||||||| || ||||| ||| |||||||||||||| |||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39461111 |
ctggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgagaccccttcccggaccctgcgtatgcgggagctttag |
39461012 |
T |
 |
| Q |
205 |
tgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39461011 |
tgcaccgggttgccctttt |
39460993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 106 - 221
Target Start/End: Original strand, 45071284 - 45071398
Alignment:
| Q |
106 |
tctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||| |
|
|
| T |
45071284 |
tctggaaacagcctcttgtgtaaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagt |
45071382 |
T |
 |
| Q |
206 |
gcaccgggttgccctt |
221 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45071383 |
gcaccgggttgccctt |
45071398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 30454210 - 30454095
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | |||||| ||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30454210 |
ctggaaacagcctcttgtgtaaaacaa--ggtaaggctgcgtacgatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
30454113 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30454112 |
caccgggttgcccttttt |
30454095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 107 - 225
Target Start/End: Original strand, 25250542 - 25250662
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| || ||||||||||||||||||| | ||| |||||||||||||| ||||||||||||||||||| |||| ||||||||||||| ||||| |
|
|
| T |
25250542 |
ctggaaacagcctattgtgtaaaaaatagggtatggctgcgtacaatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagatttag |
25250641 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttttta |
225 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
25250642 |
tgcaccgggttgcccttttta |
25250662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 107 - 220
Target Start/End: Original strand, 29877114 - 29877227
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| || |||||||||||| |||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
29877114 |
ctggaaacagccttttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcgttagtg |
29877213 |
T |
 |
| Q |
207 |
caccgggttgccct |
220 |
Q |
| |
|
|||| || |||||| |
|
|
| T |
29877214 |
caccaggctgccct |
29877227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 7136644 - 7136525
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| ||| |||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7136644 |
ctggaaacaacctcttgtgtaaaaaccagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttag |
7136545 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||| |||||||| |
|
|
| T |
7136544 |
tgcaccgggttacccttttt |
7136525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 110 - 222
Target Start/End: Original strand, 13160725 - 13160836
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
209 |
Q |
| |
|
||||||| |||||||||||||| |||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| | |
|
|
| T |
13160725 |
gaaacagcctcttgtgtaaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgc |
13160823 |
T |
 |
| Q |
210 |
cgggttgcccttt |
222 |
Q |
| |
|
||||||||||||| |
|
|
| T |
13160824 |
cgggttgcccttt |
13160836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 108 - 223
Target Start/End: Original strand, 19729363 - 19729476
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||||||||||| ||||||| | ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
19729363 |
tggaaacagtctcttatgtaaaaca--gggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatacgggagctctagtgc |
19729460 |
T |
 |
| Q |
208 |
accgggttgccctttt |
223 |
Q |
| |
|
|| || |||||||||| |
|
|
| T |
19729461 |
actggattgccctttt |
19729476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 107 - 222
Target Start/End: Complemental strand, 29521800 - 29521685
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||| ||||||| |||||||| ||| ||||||||||||||||||||||| ||| |||| |||||||| |||||||||||||||||| |
|
|
| T |
29521800 |
ctggaaacagcctcttgtttaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaacccatcccagaccctgcgtatgcgggagctttagtg |
29521701 |
T |
 |
| Q |
207 |
caccgggttgcccttt |
222 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
29521700 |
caccgggttgctcttt |
29521685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 107 - 222
Target Start/End: Original strand, 2626539 - 2626657
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaata---gggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttta |
203 |
Q |
| |
|
|||||||||| ||||||||||||||| | ||||||||||| ||||||||||||||||| |||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
2626539 |
ctggaaacagcctcttgtgtaaaaaaaaacagggtaagactgcgtacaatacaccaaatgatgggaccccttcccagaccctgcatatgcgggagcttca |
2626638 |
T |
 |
| Q |
204 |
gtgcaccgggttgcccttt |
222 |
Q |
| |
|
||||||| | ||||||||| |
|
|
| T |
2626639 |
gtgcaccagattgcccttt |
2626657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 113 - 222
Target Start/End: Original strand, 16225045 - 16225156
Alignment:
| Q |
113 |
acagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
|||| ||||| ||||||||| |||||||||||| |||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16225045 |
acagcctcttatgtaaaaaacagggtaagactgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcacc |
16225144 |
T |
 |
| Q |
211 |
gggttgcccttt |
222 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
16225145 |
gggttgtccttt |
16225156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 148 - 224
Target Start/End: Original strand, 26102578 - 26102654
Alignment:
| Q |
148 |
tacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26102578 |
tacaatacaccaaatggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgcccttttt |
26102654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 107 - 223
Target Start/End: Original strand, 26954152 - 26954271
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagcttta |
203 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| ||| |||||||||||||| |||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
26954152 |
ctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagacctcgcatatgcgggagcttta |
26954251 |
T |
 |
| Q |
204 |
gtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||||| ||||||||||||| |
|
|
| T |
26954252 |
gtgcactgggttgccctttt |
26954271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 109 - 225
Target Start/End: Original strand, 10857850 - 10857967
Alignment:
| Q |
109 |
ggaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
|||||| | ||||||||||||||| |||||||| ||| | |||||||||||| |||||||||| ||||| ||||| ||| ||||||||||||||||||| |
|
|
| T |
10857850 |
ggaaaccgcctcttgtgtaaaaaaacagggtaaggctgcgcacaatacaccaattggtgggaccacttcctggaccttgcgtatgcgggagctttagtgc |
10857949 |
T |
 |
| Q |
208 |
accgggttgcccttttta |
225 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
10857950 |
accgggttgcccttttta |
10857967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 107 - 216
Target Start/End: Complemental strand, 20284188 - 20284075
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaata--gggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagcttt |
202 |
Q |
| |
|
|||||||||| ||||||| ||||||| | ||||||| ||| |||||||||||||| ||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
20284188 |
ctggaaacagcctcttgtataaaaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagtttt |
20284089 |
T |
 |
| Q |
203 |
agtgcaccgggttg |
216 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
20284088 |
agtgcaccgggttg |
20284075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 107 - 213
Target Start/End: Complemental strand, 8484053 - 8483947
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| ||||||||||||||| |||| ||| ||| |||||||||||||| |||||||||||| |||| |||||||| |||||||||||||||| | |
|
|
| T |
8484053 |
ctggaaacaacctcttgtgtaaaaaacagggcaaggctgcgtacaatacaccaattggtgggaccccatcccagaccctgcgtatgcgggagctttaggg |
8483954 |
T |
 |
| Q |
207 |
caccggg |
213 |
Q |
| |
|
||||||| |
|
|
| T |
8483953 |
caccggg |
8483947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 110 - 211
Target Start/End: Complemental strand, 24365172 - 24365071
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgca |
208 |
Q |
| |
|
||||||| |||||||||||||||| |||||||| ||| | ||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
24365172 |
gaaacagcctcttgtgtaaaaaatcagggtaaggctgcgaacaatacaccaaatggtgggaccccttcccggaccctgcgtatgtgggagcttt-gtgca |
24365074 |
T |
 |
| Q |
209 |
ccg |
211 |
Q |
| |
|
||| |
|
|
| T |
24365073 |
ccg |
24365071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 18164874 - 18164758
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| || ||||||||||||||| | || |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
18164874 |
ctggaaacagcctcttgtgtaaaaac-agggtaaggttgcgtacaatacaccaaaggatgtgaccatttcccggaccctgcgtatgcgggagctttagtg |
18164776 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
18164775 |
caccgggttgccattttt |
18164758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 107 - 216
Target Start/End: Complemental strand, 21070817 - 21070703
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaata---gggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctt |
201 |
Q |
| |
|
|||||||||| ||||||| ||||||| | ||||||| ||| |||||||||||||| ||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
21070817 |
ctggaaacagcctcttgtataaaaaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttt |
21070718 |
T |
 |
| Q |
202 |
tagtgcaccgggttg |
216 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
21070717 |
tagtgcaccgggttg |
21070703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 106 - 225
Target Start/End: Complemental strand, 44742635 - 44742515
Alignment:
| Q |
106 |
tctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| |||| ||||||||||| |||||||| ||| |||||||||||| |||||||||||||||||| ||||||| | |||||||||| |||| |
|
|
| T |
44742635 |
tctggaaacaatctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcttggaccctacggatgcgggagcattag |
44742536 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttttta |
225 |
Q |
| |
|
||||||||| ||||| ||||| |
|
|
| T |
44742535 |
tgcaccggggtgcccctttta |
44742515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 118 - 217
Target Start/End: Original strand, 5689662 - 5689761
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgc |
217 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||||||||||||||||||| ||||||||||| ||| ||| |||| ||||||||||||||||||| |||| |
|
|
| T |
5689662 |
ctcttgtgtaaaaagcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaaccatgcgtatgtgggagctttagtgcaccggtttgc |
5689761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 107 - 209
Target Start/End: Complemental strand, 44781621 - 44781517
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
||||||||| ||||||||||||| | |||||||| ||||||||||||||||||| || ||||||||| |||| |||||||| |||||||||||||||| |
|
|
| T |
44781621 |
ctggaaacaacctcttgtgtaaaagacagggtaaggctgtgtacaatacaccaaaaatgttgggaccccgtcccagaccctgcgtatgcgggagctttag |
44781522 |
T |
 |
| Q |
205 |
tgcac |
209 |
Q |
| |
|
||||| |
|
|
| T |
44781521 |
tgcac |
44781517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 107 - 210
Target Start/End: Original strand, 22598177 - 22598279
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| || ||||||||||||||| ||||| ||||| |||||||||| ||| ||||||||| |||||||| |
|
|
| T |
22598177 |
ctggaaacaacctcttgtgtaaaaaacagggtaaggctatgtacaatacaccaattggtgagaccctttcccggaccttgcgtatgcggga-ctttagtg |
22598275 |
T |
 |
| Q |
207 |
cacc |
210 |
Q |
| |
|
|||| |
|
|
| T |
22598276 |
cacc |
22598279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 155 - 222
Target Start/End: Original strand, 28407471 - 28407538
Alignment:
| Q |
155 |
caccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||| |
|
|
| T |
28407471 |
caccaaatggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgcccttt |
28407538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 108 - 201
Target Start/End: Complemental strand, 14018083 - 14017989
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctt |
201 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||| ||||||||||| ||| |||||||||| ||||| |||||||||| |||||| ||||| |
|
|
| T |
14018083 |
tggaaacagtctcttgtgtaaaaaacagggtgagactgcgtacaatacactaaattggtgggaccacttcctggaccctgcagatgcggtagctt |
14017989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 107 - 199
Target Start/End: Complemental strand, 20869611 - 20869523
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagc |
199 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||| |||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20869611 |
ctggaaacagcctcttgtgtaaaaca--gggtaaggctgtgtacaatacaccaa--ggtgagaccccttcccggaccctgcatatgcgggagc |
20869523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 118 - 223
Target Start/End: Original strand, 31457204 - 31457308
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgc |
217 |
Q |
| |
|
|||||||||||||| |||| ||| ||| |||||||||| |||||||| |||||||||||| ||||||| |||||||||||| ||||||||||| |||| |
|
|
| T |
31457204 |
ctcttgtgtaaaaa-taggaaaaggctgcgtacaatacatcaaatggtaggaccccttcccaaaccctgcgtatgcgggagctctagtgcaccggattgc |
31457302 |
T |
 |
| Q |
218 |
cctttt |
223 |
Q |
| |
|
|||||| |
|
|
| T |
31457303 |
cctttt |
31457308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 159 - 225
Target Start/End: Original strand, 16013528 - 16013594
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttta |
225 |
Q |
| |
|
|||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16013528 |
aaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttgtccttttta |
16013594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 107 - 212
Target Start/End: Original strand, 389663 - 389770
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgt--aaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
||||||||| ||||||||| |||||| |||||||| || ||||||||||||||||| ||||| ||||| || |||||||| |||||| ||||||||| |
|
|
| T |
389663 |
ctggaaacaccctcttgtgtcaaaaaaacagggtaaggttgcgtacaatacaccaaatgatgggatccctttcctgaccctgcgtatgcgagagctttag |
389762 |
T |
 |
| Q |
205 |
tgcaccgg |
212 |
Q |
| |
|
|||||||| |
|
|
| T |
389763 |
tgcaccgg |
389770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 159 - 223
Target Start/End: Complemental strand, 35107374 - 35107310
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35107374 |
aaatggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgccctttt |
35107310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 107 - 219
Target Start/End: Complemental strand, 17250992 - 17250879
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||| ||| ||||||||||||||| ||| |||| | | |||||||||||||| |||||||||||| |||||| ||||||| |||| |||||||||| |
|
|
| T |
17250992 |
ctggaagcagcctcttgtgtaaaaaacaggttaaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaaggagctttag |
17250893 |
T |
 |
| Q |
205 |
tgcaccgggttgccc |
219 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
17250892 |
tgca-cgggttgccc |
17250879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 27468141 - 27468090
Alignment:
| Q |
173 |
cttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27468141 |
cttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
27468090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 162 - 221
Target Start/End: Original strand, 27507985 - 27508044
Alignment:
| Q |
162 |
tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt |
221 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
27507985 |
tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgtcctt |
27508044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 131 - 224
Target Start/End: Original strand, 26457773 - 26457864
Alignment:
| Q |
131 |
aatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||| ||| |||||||||||||| ||||||||||||| || |||| ||| |||| |||||||||||||||||||||| || ||||| |
|
|
| T |
26457773 |
aatagggtaaggctgcgtacaatacaccaattggtgggacccct--cctgaccttgcgtatgagggagctttagtgcaccgggtttcctttttt |
26457864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 107 - 222
Target Start/End: Complemental strand, 23000333 - 23000228
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||| | ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23000333 |
ctggaaacagcctcttgtgtaaaaac-acggtaaggttccatacaatacaccaaatggtgggaccccttcccgg---------atgcgggagctttagtg |
23000244 |
T |
 |
| Q |
207 |
caccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
23000243 |
caccgggttgcccttt |
23000228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 107 - 221
Target Start/End: Complemental strand, 42083814 - 42083699
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||||||| || ||||||||||||| ||| ||| ||| ||||| || |||||| |||||||||||||||||| |||||| || | |||||||||||| |
|
|
| T |
42083814 |
ctggaaacagccttttgtgtaaaaaatggggcaaggctgcgtacagtataccaaaatggtgggaccccttcccgaaccctgtgtacgtgggagctttagt |
42083715 |
T |
 |
| Q |
206 |
gcaccgggttgccctt |
221 |
Q |
| |
|
||| ||| ||||||| |
|
|
| T |
42083714 |
gcattgggctgccctt |
42083699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 221
Target Start/End: Complemental strand, 36486627 - 36486567
Alignment:
| Q |
161 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt |
221 |
Q |
| |
|
||||||||||| ||||||||||| ||| ||||| ||||||||||||| ||||||||||||| |
|
|
| T |
36486627 |
atggtgggacctcttcccggaccttgcgtatgcaggagctttagtgccccgggttgccctt |
36486567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 138 - 201
Target Start/End: Complemental strand, 11001033 - 11000970
Alignment:
| Q |
138 |
taagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctt |
201 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||| |||||| ||||| ||||||| |
|
|
| T |
11001033 |
taaggctgtgtacaatacaccaaatggtgggacccctacccgaaccctgtttatgcaggagctt |
11000970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 106 - 225
Target Start/End: Original strand, 36918143 - 36918262
Alignment:
| Q |
106 |
tctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||||||| | |||| ||||||||| |||||||| |||||||||||||||||||| || ||| ||||||| ||||| |||||| |||||||| | |
|
|
| T |
36918143 |
tctggaaacaatttcttatgtaaaaaacagggtaaggctgtgtacaatacaccaaatagtaggattccttcccaaaccctatgtatgcgagagctttaat |
36918242 |
T |
 |
| Q |
206 |
gcaccgggttgcccttttta |
225 |
Q |
| |
|
||| ||||| |||||||| |
|
|
| T |
36918243 |
gcaaaaggttgtccttttta |
36918262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 108 - 223
Target Start/End: Complemental strand, 40605019 - 40604905
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
|||||||| ||| ||||||||||||| || |||| || ||||||||||| ||||| ||| | ||||||| ||||| | ||||||||||||||||||| |
|
|
| T |
40605019 |
tggaaacaatcttttgtgtaaaaaattggataaggttgcgtacaatacactaaatgatgg-atcccttccgaaaccctacgtatgcgggagctttagtgc |
40604921 |
T |
 |
| Q |
208 |
accgggttgccctttt |
223 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
40604920 |
accgaattgccctttt |
40604905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 167 - 224
Target Start/End: Original strand, 18595918 - 18595975
Alignment:
| Q |
167 |
ggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
18595918 |
ggaccccttcccggaccctgtgtatgcgggagttttagtgcatcgggttgcctttttt |
18595975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 126 - 222
Target Start/End: Original strand, 23574560 - 23574656
Alignment:
| Q |
126 |
taaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||| |||||| |||||| |||||| |||||||||||| ||||| || ||||| ||| |||||||||||||||| || |||| ||||| |
|
|
| T |
23574560 |
taaaaaatagagtaagattgtgtataatacatcaaatggtgggattccttcgtagatcctgcgtatacgggagctttagtgcatcgtgttgtccttt |
23574656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 179 - 222
Target Start/End: Complemental strand, 23286380 - 23286337
Alignment:
| Q |
179 |
ggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
23286380 |
ggaccctgcatatgcgggagctctagtgcaccgggctgcccttt |
23286337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 107 - 185
Target Start/End: Original strand, 35105943 - 35106022
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacca-aatggtgggaccccttcccggaccct |
185 |
Q |
| |
|
||||||||| ||||||||||||| | || ||||| ||| ||||||||||||| |||||||||||| ||||| ||||||| |
|
|
| T |
35105943 |
ctggaaacaacctcttgtgtaaaagagagtgtaaggctgcgtacaatacaccagaatggtgggacctcttcctggaccct |
35106022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 134 - 203
Target Start/End: Original strand, 24245493 - 24245565
Alignment:
| Q |
134 |
agggtaagactgtgtacaatacaccaaa---tggtgggaccccttcccggaccctgcatatgcgggagcttta |
203 |
Q |
| |
|
||||||||||| ||||||| ||||||| | |||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
24245493 |
agggtaagactacgtacaatgcaccaaaaaattgtgggaccccttcctggaccctgcgtatgcgggagcttta |
24245565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 111 - 178
Target Start/End: Original strand, 43942348 - 43942417
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacc--aaatggtgggaccccttccc |
178 |
Q |
| |
|
|||||| ||||| ||| ||||| |||||||| ||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
43942348 |
aaacagcctcttatgtcaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttccc |
43942417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 173 - 222
Target Start/End: Original strand, 33867038 - 33867087
Alignment:
| Q |
173 |
cttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
||||||| ||||||| ||||| | |||||||||||||||||||||||||| |
|
|
| T |
33867038 |
cttcccgaaccctgcgtatgcagaagctttagtgcaccgggttgcccttt |
33867087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 166 - 223
Target Start/End: Original strand, 40444845 - 40444902
Alignment:
| Q |
166 |
gggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||||||||| ||||||||||| |||| ||||||||||||||||| | ||||||||| |
|
|
| T |
40444845 |
gggaccccttgccggaccctgcgtatgttggagctttagtgcaccgagctgccctttt |
40444902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 193
Target Start/End: Original strand, 11748320 - 11748407
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgc |
193 |
Q |
| |
|
||||||||| ||||| |||||||| |||||||||| | |||||||| || ||| |||| ||||||||||||| | ||||||||||| |
|
|
| T |
11748320 |
tggaaacagcctcttttgtaaaaagcagggtaagacagcgtacaatatacaaaaaatggtaggaccccttcccgaatcctgcatatgc |
11748407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 222
Target Start/End: Complemental strand, 30962815 - 30962771
Alignment:
| Q |
178 |
cggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||| |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
30962815 |
cggaccctgcgtatgcgggagatttagtgaaccgggttgcccttt |
30962771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 161 - 216
Target Start/End: Original strand, 12483584 - 12483639
Alignment:
| Q |
161 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttg |
216 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| || | |||| || ||||||||| |
|
|
| T |
12483584 |
atggtgggaccccttcccggaccctacatatgcaggggttttaatgtaccgggttg |
12483639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 159 - 224
Target Start/End: Complemental strand, 2351781 - 2351719
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||||||||||||||||| |||| ||||||| |
|
|
| T |
2351781 |
aaatggtgggaccc-ttcctagaccctgcat--gcgggagctttagtgcaccgagttgtccttttt |
2351719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 184 - 216
Target Start/End: Complemental strand, 950633 - 950601
Alignment:
| Q |
184 |
ctgcatatgcgggagctttagtgcaccgggttg |
216 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
950633 |
ctgcatatgcaggagctttagtgcaccgggttg |
950601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 113 - 172
Target Start/End: Complemental strand, 23286432 - 23286375
Alignment:
| Q |
113 |
acagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccc |
172 |
Q |
| |
|
|||| ||||||||||||| | |||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
23286432 |
acagcctcttgtgtaaaaca--gggtaaagctgcgtacaatacaccaaatggtgggaccc |
23286375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 94; Significance: 8e-46; HSPs: 74)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 107 - 225
Target Start/End: Original strand, 42805544 - 42805664
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42805544 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttag |
42805643 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttttta |
225 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42805644 |
tgcaccgggttgcccttttta |
42805664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 32758281 - 32758396
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32758281 |
ctggaaacagcctcttgtgtaaaaca--gggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
32758378 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32758379 |
caccgggttgcccttttt |
32758396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 7879658 - 7879775
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| |||||||||||||||| | |||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
7879658 |
ctggaaacaatctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtg |
7879757 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
7879758 |
caccgggttgcccttttt |
7879775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 19427004 - 19426888
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||||||||||||||||| |||||| |||| |
|
|
| T |
19427004 |
ctggaaacagcctcttgtgtaaaaaatagggtaagactgcgtacaatacaccaaatggtggga-cccttctcggaccctgcatatgcgagagcttcagtg |
19426906 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
19426905 |
caccgggttgcccttttt |
19426888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 108 - 225
Target Start/End: Original strand, 42798690 - 42798807
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| ||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
42798690 |
tggaaacagtctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccctttcccggaccctgcatatgcgggagctatagtgc |
42798789 |
T |
 |
| Q |
208 |
accgggttgcccttttta |
225 |
Q |
| |
|
| |||||||||||||||| |
|
|
| T |
42798790 |
atcgggttgcccttttta |
42798807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 21172122 - 21172008
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21172122 |
ctggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
21172025 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
21172024 |
caccgggttgccctttt |
21172008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 107 - 222
Target Start/End: Complemental strand, 2541134 - 2541019
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| ||| |||| ||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
2541134 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtactatacaccaaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtg |
2541035 |
T |
 |
| Q |
207 |
caccgggttgcccttt |
222 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
2541034 |
caccgggtttcccttt |
2541019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 107 - 221
Target Start/End: Complemental strand, 11617703 - 11617589
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||| ||| |||||||| |
|
|
| T |
11617703 |
ctggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcaggacctttagtg |
11617604 |
T |
 |
| Q |
207 |
caccgggttgccctt |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
11617603 |
caccgggttgccctt |
11617589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 107 - 220
Target Start/End: Complemental strand, 35334929 - 35334818
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
35334929 |
ctggaaacagtctc--gtgtaaaaaacagggtaagactgtgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtg |
35334832 |
T |
 |
| Q |
207 |
caccgggttgccct |
220 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
35334831 |
caccgggtttccct |
35334818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 42391213 - 42391098
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||||||||| | ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42391213 |
ctggaaacagcttcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
42391116 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42391115 |
caccgggttgcccttttt |
42391098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 107 - 222
Target Start/End: Original strand, 47716479 - 47716596
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| ||| |||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
47716479 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttgg |
47716578 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
47716579 |
tgcaccgggttgcccttt |
47716596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 27629654 - 27629771
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| || ||| |||||||||||||||||||||||||||||| |||||||||||||| ||||| |||| |
|
|
| T |
27629654 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtaaaatacaccaaatggtgggaccccttcccgggccctgcatatgcggtagcttcagtg |
27629753 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
27629754 |
caccgggttgcccttttt |
27629771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 107 - 222
Target Start/End: Complemental strand, 10693186 - 10693073
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10693186 |
ctggaaacagcctcttgtgtaaaaga--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
10693089 |
T |
 |
| Q |
207 |
caccgggttgcccttt |
222 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
10693088 |
cactgggttgcccttt |
10693073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 108 - 222
Target Start/End: Complemental strand, 48735234 - 48735122
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
|||||||| ||||||||||||| | |||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48735234 |
tggaaacaacctcttgtgtaaaacac--ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgc |
48735137 |
T |
 |
| Q |
208 |
accgggttgcccttt |
222 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
48735136 |
accgggttgcccttt |
48735122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 38262311 - 38262194
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| || |||||||||||||||| ||||||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
38262311 |
ctggaaacagtctcttgtgtaaaaaatatggtaatgttgcatacaatacaccaaatgatgggaccccttcccgaacactgcgtatgcgggagctttagtg |
38262212 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
38262211 |
caccggattgcccttttt |
38262194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 110 - 223
Target Start/End: Original strand, 40463900 - 40464012
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
209 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| ||| ||| |||||||||||||||||||||||||| |||||||||| ||||||||||||| ||||||| |
|
|
| T |
40463900 |
gaaacagtctcttgtgtaaaaact-gggtaaggctgcgtataatacaccaaatggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcac |
40463998 |
T |
 |
| Q |
210 |
cgggttgccctttt |
223 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
40463999 |
cgagttgccctttt |
40464012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 106 - 222
Target Start/End: Complemental strand, 23419790 - 23419674
Alignment:
| Q |
106 |
tctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |||| ||| | |||||| |||||||| |
|
|
| T |
23419790 |
tctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcctagaccttgcgtgtgcgggggctttagt |
23419691 |
T |
 |
| Q |
206 |
gcaccgggttgcccttt |
222 |
Q |
| |
|
||| |||| |||||||| |
|
|
| T |
23419690 |
gcatcgggctgcccttt |
23419674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 119 - 220
Target Start/End: Complemental strand, 18512555 - 18512455
Alignment:
| Q |
119 |
tcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcc |
218 |
Q |
| |
|
||||||||||||| ||||||||| ||| |||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |||||| |||||||| |
|
|
| T |
18512555 |
tcttgtgtaaaaa-tagggtaaggctgcgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcactgggttgcc |
18512457 |
T |
 |
| Q |
219 |
ct |
220 |
Q |
| |
|
|| |
|
|
| T |
18512456 |
ct |
18512455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 110 - 221
Target Start/End: Original strand, 29907442 - 29907552
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgca |
208 |
Q |
| |
|
||||||| |||||||||||||||||| ||||| ||| || |||||||||||| |||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
29907442 |
gaaacagcctcttgtgtaaaaaatagtgtaaggctgcgttcaatacaccaaaatggtgggaccccatcccggaccctg--tatgcgggagctttagtgca |
29907539 |
T |
 |
| Q |
209 |
ccgggttgccctt |
221 |
Q |
| |
|
||||||||||||| |
|
|
| T |
29907540 |
ccgggttgccctt |
29907552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 34626322 - 34626206
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||| |||||||||| |||||||| ||| || |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34626322 |
ctggaaacagcctcctgtgtaaaaac-agggtaaggctgcgttcaatacaccaaatggtgggatcccttcccggaccctgcgtatgcgggagctttagtt |
34626224 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
34626223 |
catcgggttgcccttttt |
34626206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 43557492 - 43557612
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagc-ttta |
203 |
Q |
| |
|
|||||||||| ||||||||||||||| || ||||| ||| ||||||||||||| |||||||||||||| |||||||| |||| ||||||||||| |||| |
|
|
| T |
43557492 |
ctggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgggaccccctcccggactctgcgtatgcgggagctttta |
43557591 |
T |
 |
| Q |
204 |
gtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43557592 |
gtgcaccgggttgcccttttt |
43557612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 107 - 222
Target Start/End: Complemental strand, 22699085 - 22698967
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacc--aaatggtgggaccc-cttcccggaccctgcatatgcgggagcttta |
203 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||| |||||||||||| |||||||||||||| ||||||||||||| |||||||||||| || |
|
|
| T |
22699085 |
ctggaaatagtctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaaaatggtgggacccttttcccggaccctgtgtatgcgggagctata |
22698986 |
T |
 |
| Q |
204 |
gtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
22698985 |
gtgcaccgggttacccttt |
22698967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 108 - 213
Target Start/End: Original strand, 21566456 - 21566562
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||| | ||||||||||||||| || | ||||||| ||||||||||||||| |||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21566456 |
tggaaaccgcctcttgtgtaaaaaacagaggaagactgcgtacaatacaccaaaatggtaggaccccttcccgaaccctgcatatgcgggagctttagtg |
21566555 |
T |
 |
| Q |
207 |
caccggg |
213 |
Q |
| |
|
||||||| |
|
|
| T |
21566556 |
caccggg |
21566562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 1408477 - 1408594
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||| || ||||||||||||||| | |||||| |||||||||||||| |||||||||||||||||||||||||||||| ||||| | | ||||||| |
|
|
| T |
1408477 |
ctggaaatagcctcttgtgtaaaaaacaaggtaaggctgtgtacaatacagcaaatggtgggaccccttcccggaccctgcgtatgcagaatctttagtt |
1408576 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||| ||||| ||||| |
|
|
| T |
1408577 |
caccggattgcctttttt |
1408594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 147 - 224
Target Start/End: Complemental strand, 27889391 - 27889314
Alignment:
| Q |
147 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
27889391 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgcccttttt |
27889314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 31591222 - 31591108
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| ||||||||||||| | || |||| ||| |||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
31591222 |
ctggaaacaacctcttgtgtaaaacagag--taaggctgcgtacaatacaataaatggtgggaccccttcccggaccttgcatatgcgggagctctagtg |
31591125 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
31591124 |
caccgggttgccctttt |
31591108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 129 - 221
Target Start/End: Original strand, 11741835 - 11741927
Alignment:
| Q |
129 |
aaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt |
221 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||| ||||||||||| ||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
11741835 |
aaaatagggtaaggctgcgtacaatacaccaaatggtgggatcccttcccggattctgcacatgcgggagctctagtgcaccgggttgccctt |
11741927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 128 - 224
Target Start/End: Original strand, 19265855 - 19265950
Alignment:
| Q |
128 |
aaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||| |||||||| ||| ||||||||||||||||||||||||||||||||||| ||| |||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
19265855 |
aaaaagagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgga-cctacatatgtgggagctttagtgcaccgggctgcccttttt |
19265950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 107 - 214
Target Start/End: Original strand, 38604547 - 38604654
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt-agt |
205 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| ||| |||||||||||||||||||| |||||||| ||||||||||| |||||||||||||| ||| |
|
|
| T |
38604547 |
ctggaaacagcctcttgtgtaaaaac-agggtaaggctgcgtacaatacaccaaatggtgagacccctttccggaccctgcgtatgcgggagctttaagt |
38604645 |
T |
 |
| Q |
206 |
gcaccgggt |
214 |
Q |
| |
|
||||||||| |
|
|
| T |
38604646 |
gcaccgggt |
38604654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 106 - 221
Target Start/End: Original strand, 42476892 - 42477005
Alignment:
| Q |
106 |
tctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| ||| ||||||||||||||||||||||||||||||| | | ||||||||||||||||| |||| |
|
|
| T |
42476892 |
tctggaaacagtctcttgtgtaaaacaa--ggtaaggctgcgtacaatacaccaaatggtgggaccccttcctaggctctgcatatgcgggagctctagt |
42476989 |
T |
 |
| Q |
206 |
gcaccgggttgccctt |
221 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
42476990 |
gcaccaggttgccctt |
42477005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 108 - 221
Target Start/End: Original strand, 18747507 - 18747621
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| || |||||||||||| |||||||| ||| ||| |||||||||| |||||||||||||||| | ||||||| |||||||||||||||||| |
|
|
| T |
18747507 |
tggaaacagccttttgtgtaaaaaagcagggtaaggctgcgtataatacaccaattggtgggaccccttcctgaaccctgcgtatgcgggagctttagtg |
18747606 |
T |
 |
| Q |
207 |
caccgggttgccctt |
221 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
18747607 |
caccgggctgccctt |
18747621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 107 - 222
Target Start/End: Original strand, 23231577 - 23231692
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||| || ||||||||||||| ||| |||||| ||| ||| |||||||| |||| ||||||||||||||| ||||||| ||||||| |||||||||| |
|
|
| T |
23231577 |
ctggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagctttagtg |
23231676 |
T |
 |
| Q |
207 |
caccgggttgcccttt |
222 |
Q |
| |
|
||||| ||| |||||| |
|
|
| T |
23231677 |
caccgagtttcccttt |
23231692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 107 - 218
Target Start/End: Complemental strand, 33872024 - 33871914
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| |||||||||||||| ||| |||| ||| |||||||||||||||||||||||||||||||| ||||||| |||||| ||||||||||| |
|
|
| T |
33872024 |
ctggaaacaacctcttgtgtaaaaac-aggataaggctgcgtacaatacaccaaatggtgggaccccttcccagaccctgtgtatgcgagagctttagtg |
33871926 |
T |
 |
| Q |
207 |
caccgggttgcc |
218 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
33871925 |
caccaggttgcc |
33871914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 112 - 223
Target Start/End: Complemental strand, 35787378 - 35787268
Alignment:
| Q |
112 |
aacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg |
211 |
Q |
| |
|
||||| |||||||||||||| | |||||| || |||||||||||||||||| |||||||||||||||||| ||| ||||||||||||| | ||||||| |
|
|
| T |
35787378 |
aacagcctcttgtgtaaaaac-atggtaaggttgcgtacaatacaccaaatggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccg |
35787280 |
T |
 |
| Q |
212 |
ggttgccctttt |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
35787279 |
ggttgccctttt |
35787268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 47077968 - 47077853
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||| || ||||||||||| |||||||||||||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
47077968 |
ctggaaacagtctcttgtgtaaaa--tagagtaaagttgcgtacaatacacaaaatggtgggaccccttcccaaaccctacatatgcgggagctctagtg |
47077871 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||| ||||| ||||| |
|
|
| T |
47077870 |
caccggattgcctttttt |
47077853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 110 - 221
Target Start/End: Original strand, 16341301 - 16341413
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgca |
208 |
Q |
| |
|
||||||| ||||||||||||||| |||||||| || ||||||||||||||| ||||||| || ||||||||||| |||||||||||||||| ||||| |
|
|
| T |
16341301 |
gaaacagcctcttgtgtaaaaaacagggtaaggctacgtacaatacaccaaaatggtgggccctcttcccggacctatcatatgcgggagctttggtgca |
16341400 |
T |
 |
| Q |
209 |
ccgggttgccctt |
221 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
16341401 |
ccgggctgccctt |
16341413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 134 - 225
Target Start/End: Complemental strand, 39093528 - 39093436
Alignment:
| Q |
134 |
agggtaagactgtgtacaatacacca-aatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttta |
225 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||| ||||||||||| | ||||||||| | ||||||||||||||||| ||||||||||| |
|
|
| T |
39093528 |
agggtaagactgtgtacaatacaccataatagtgggaacccttcccggaacttgcatatgcagaagctttagtgcaccgggctgcccttttta |
39093436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 118 - 213
Target Start/End: Complemental strand, 28362249 - 28362155
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggg |
213 |
Q |
| |
|
||||||||||||||| |||||| ||| |||||||||||||||||||||||||||||||| |||| |||||||| ||||||||| |||||||||| |
|
|
| T |
28362249 |
ctcttgtgtaaaaaacttggtaaggctgcgtacaatacaccaaatggtgggaccccttcccagaccttgcatatgtgggagcttt-gtgcaccggg |
28362155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 107 - 198
Target Start/End: Complemental strand, 48123599 - 48123508
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggag |
198 |
Q |
| |
|
|||||||||| |||||||||||| || ||||||| |||| |||||||||||||||||||||||||||| | ||||| |||||||||||||| |
|
|
| T |
48123599 |
ctggaaacagcctcttgtgtaaataacagggtaaaactgcatacaatacaccaaatggtgggacccctttctggaccatgcatatgcgggag |
48123508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 107 - 212
Target Start/End: Complemental strand, 2663048 - 2662946
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||| ||| ||||||||||||||||||||||| ||||| | ||||||||||||||||||||| ||| | |
|
|
| T |
2663048 |
ctggaaacagcctcttgtgtaaaa--tagggtaaggctgcgtacaatacaccaaatggtggga-cccttttcagaccctgcatatgcgggagctctagcg |
2662952 |
T |
 |
| Q |
207 |
caccgg |
212 |
Q |
| |
|
|||||| |
|
|
| T |
2662951 |
caccgg |
2662946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 135 - 224
Target Start/End: Original strand, 13805149 - 13805237
Alignment:
| Q |
135 |
gggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||| ||||||||| |||||||||||||| |||||| ||| | |||||||| |
|
|
| T |
13805149 |
gggtaaggctgtgtacaatacaccaaatggtgggaccacttcctggaccctgcgtatgcgggagcttt-gtgcactgggctacccttttt |
13805237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 120 - 201
Target Start/End: Original strand, 19266483 - 19266564
Alignment:
| Q |
120 |
cttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctt |
201 |
Q |
| |
|
|||| |||||||| |||||||| ||| |||||||||||||||| |||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
19266483 |
cttgcgtaaaaaacagggtaaggctgcgtacaatacaccaaattgtgggatcccttcccggaccctgcgtatgcgggagctt |
19266564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 107 - 193
Target Start/End: Original strand, 46354214 - 46354302
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgc |
193 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| ||| ||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
46354214 |
ctggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgc |
46354302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 107 - 198
Target Start/End: Complemental strand, 14099121 - 14099030
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggag |
198 |
Q |
| |
|
||||||| || || |||||||||||| ||| |||||||| ||||||||||||||||||||||||||||||||| ||||| | ||||| |||| |
|
|
| T |
14099121 |
ctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctacgtatgcaggag |
14099030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 107 - 198
Target Start/End: Complemental strand, 14409138 - 14409047
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggag |
198 |
Q |
| |
|
||||||| || || |||||||||||| ||| |||||||| ||||||||||||||||||||||||||||||||| ||||| | ||||| |||| |
|
|
| T |
14409138 |
ctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctacgtatgcaggag |
14409047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 144 - 225
Target Start/End: Complemental strand, 23619055 - 23618974
Alignment:
| Q |
144 |
tgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttta |
225 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| | |||| ||| | ||| |||||||||||||| |||||||||||||||| |
|
|
| T |
23619055 |
tgtgtacaatacatcaaatggtgggaccccttcgcagaccttgcgtttgcaggagctttagtgcagcgggttgcccttttta |
23618974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 32233249 - 32233133
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| | | ||| | ||||||||||||||||| ||||||| |||||||||||| |||||||| |||| |
|
|
| T |
32233249 |
ctggaaacaacctcttgtgtaaaaac-agggtaaggcagcgtatattacaccaaatggtgggattccttcccaaaccctgcatatgagggagcttcagtg |
32233151 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
32233150 |
caccgggctgcccttttt |
32233133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 162 - 222
Target Start/End: Complemental strand, 45018983 - 45018923
Alignment:
| Q |
162 |
tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
45018983 |
tggtggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgcccttt |
45018923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 108 - 224
Target Start/End: Original strand, 25198746 - 25198863
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||||| |||||||||||| | |||||||| | ||| ||| ||| ||||||| ||| |||||||| |||||| | |||| | ||||||||||| |
|
|
| T |
25198746 |
tggaaacagtcttttgtgtaaaaaaacaaggtaagaccgcgtataatgcactaaatggtaggatcccttcccagacccttcgtatgtgagagctttagtg |
25198845 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
25198846 |
caccgggttgcacttttt |
25198863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 107 - 197
Target Start/End: Original strand, 7644976 - 7645066
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcggga |
197 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||| | |||||||||||| |||| |||||||||||| || |||||||| ||||||||| |
|
|
| T |
7644976 |
ctggaaacagcctcttgtgtaaaaaacagggtaagatagcgtacaatacaccaaaattgtgggacccctt-cctgaccctgcgtatgcggga |
7645066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 118 - 208
Target Start/End: Complemental strand, 8149050 - 8148960
Alignment:
| Q |
118 |
ctcttgtgt-aaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgca |
208 |
Q |
| |
|
||||||||| ||||||||||||||| || |||||||||||||||||||||||||||||||| || | ||| |||||| ||| ||||||||| |
|
|
| T |
8149050 |
ctcttgtgttaaaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccaga-cttgcgtatgcgagagttttagtgca |
8148960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 123 - 225
Target Start/End: Complemental strand, 13792250 - 13792147
Alignment:
| Q |
123 |
gtgtaaaaaatagggtaagactgtgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt |
221 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||| ||||||||||| || ||||||| ||||| |||||||| |||||||| | ||||||| |
|
|
| T |
13792250 |
gtgtaaaaaacttggtaagactgcatacaatacacccaaatggcgggaccccttctcgaaccctgcgtatgctggagcttttgtgcaccgagctgccctt |
13792151 |
T |
 |
| Q |
222 |
ttta |
225 |
Q |
| |
|
|||| |
|
|
| T |
13792150 |
ttta |
13792147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 107 - 203
Target Start/End: Original strand, 35203459 - 35203557
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcgggagcttta |
203 |
Q |
| |
|
||||||||| |||||||||||||||| ||| |||||||| |||||||| ||| ||||||||||| ||||||| | || || | ||||||||||||||| |
|
|
| T |
35203459 |
ctggaaacattctcttgtgtaaaaaacaggataagactgcgtacaatataccaaaaatggtgggatcccttcctgaactctacgtatgcgggagcttta |
35203557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 110 - 221
Target Start/End: Complemental strand, 3469291 - 3469176
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaata--gggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||| |||||||||||||||| | ||||| | || ||||||||||||||| ||| |||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
3469291 |
gaaacattctcttgtgtaaaaaaaacagggtacggttgcgtacaatacaccaaaaatggcgggaccccttcctagaccctgtgtatgcgggagctttagt |
3469192 |
T |
 |
| Q |
206 |
gcaccgggttgccctt |
221 |
Q |
| |
|
|| | ||||||||||| |
|
|
| T |
3469191 |
gcgctgggttgccctt |
3469176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 118 - 223
Target Start/End: Complemental strand, 23066029 - 23065924
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgc |
217 |
Q |
| |
|
||||||| ||||||| ||| ||| || ||||||||||||| ||| ||||| ||||| ||| | |||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
23066029 |
ctcttgtttaaaaaacaggataaagttgcgtacaatacaccatatgatgggatccctttccgaatcctgcatatgtgggagctttggtgcaccggattgc |
23065930 |
T |
 |
| Q |
218 |
cctttt |
223 |
Q |
| |
|
|||||| |
|
|
| T |
23065929 |
cctttt |
23065924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 150 - 203
Target Start/End: Complemental strand, 28078204 - 28078151
Alignment:
| Q |
150 |
caatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||| |||||||| |
|
|
| T |
28078204 |
caatacaccaaatggtgggaccccttcccgaatcctgcatatgcgagagcttta |
28078151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 134 - 219
Target Start/End: Original strand, 33500560 - 33500645
Alignment:
| Q |
134 |
agggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccc |
219 |
Q |
| |
|
|||||||||||| |||| |||||| ||| |||||||||||||||||||||||||| ||||||||| ||| |||| ||||||||||| |
|
|
| T |
33500560 |
agggtaagactgcgtactatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcgggatcttcagtg--ccgggttgccc |
33500645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 175 - 224
Target Start/End: Original strand, 36602535 - 36602584
Alignment:
| Q |
175 |
tcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36602535 |
tcccagaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
36602584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 107 - 207
Target Start/End: Complemental strand, 42102000 - 42101899
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||||||| ||||| |||||||| ||||||| |||| ||||| ||| | ||| ||||||||||| |||||||||||||| ||| ||| ||||||||| |
|
|
| T |
42102000 |
ctggaaacagcctcttccgtaaaaaacagggtaacactgcgtacagtactctaaagtggtgggaccctttcccggaccctgcgtatccggcagctttagt |
42101901 |
T |
 |
| Q |
206 |
gc |
207 |
Q |
| |
|
|| |
|
|
| T |
42101900 |
gc |
42101899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 159 - 223
Target Start/End: Original strand, 39123967 - 39124031
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||| ||||||| | ||||||||| |
|
|
| T |
39123967 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccaagctgccctttt |
39124031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 106 - 161
Target Start/End: Complemental strand, 5180273 - 5180218
Alignment:
| Q |
106 |
tctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa |
161 |
Q |
| |
|
||||||||||| ||||||||| ||||| ||||||||||||||||||| |||||||| |
|
|
| T |
5180273 |
tctggaaacagcctcttgtgtcaaaaacagggtaagactgtgtacaacacaccaaa |
5180218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 107 - 222
Target Start/End: Complemental strand, 14732937 - 14732821
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||| ||||||||| |||||||| ||| || |||||||||||| ||||| || |||||||| |||||| |||||||||||||||| |
|
|
| T |
14732937 |
ctggaaacagcctcccatgtaaaaaacagggtaaggctgcgt-caatacaccaaaaatggtgaaactccttcccgaaccctgtttatgcgggagctttag |
14732839 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||| ||| ||||| |
|
|
| T |
14732838 |
tgcaccggattgtccttt |
14732821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 36267893 - 36267827
Alignment:
| Q |
147 |
gtacaatacaccaaatggtgggacccctt-cccggaccctgcatatgcgggagctttagtgcaccgg |
212 |
Q |
| |
|
||||||||||||||||||| |||||| || |||| |||||| |||||||||||||||||||||||| |
|
|
| T |
36267893 |
gtacaatacaccaaatggttggacccatttcccgaaccctgtgtatgcgggagctttagtgcaccgg |
36267827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 148 - 209
Target Start/End: Complemental strand, 21139822 - 21139761
Alignment:
| Q |
148 |
tacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
209 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| || ||| ||||||| ||||||||||||| |
|
|
| T |
21139822 |
tacagtacaccaaatggtgggaccccttcccgaactctgtgtatgcggaagctttagtgcac |
21139761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 159 - 224
Target Start/End: Original strand, 45811919 - 45811983
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||| ||||| || |||||||| ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
45811919 |
aaatggtgggatccctttccagaccctgcttatgcaggagctttagtgca-cgggttgcccttttt |
45811983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 171 - 219
Target Start/End: Complemental strand, 42495913 - 42495865
Alignment:
| Q |
171 |
cccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccc |
219 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
42495913 |
cccttcccggaccctgcgtatgcgggagctttagtgcaccccgttgccc |
42495865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 107 - 178
Target Start/End: Complemental strand, 15108511 - 15108441
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttccc |
178 |
Q |
| |
|
||||||||||| ||||||||||||| ||| |||| |||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
15108511 |
ctggaaacagtttcttgtgtaaaaacaagg-taaggctgtgtacaatacatcaaatagtgggatcccttccc |
15108441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 191 - 224
Target Start/End: Complemental strand, 44171668 - 44171635
Alignment:
| Q |
191 |
tgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44171668 |
tgcgggagctttagtgcaccgggttgcccttttt |
44171635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 137 - 212
Target Start/End: Complemental strand, 1524258 - 1524183
Alignment:
| Q |
137 |
gtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg |
212 |
Q |
| |
|
||||||| | |||||| ||||||||||| |||| ||||| || |||| ||||||||||||||||||||||||| |
|
|
| T |
1524258 |
gtaagacagcgtacaaaacaccaaatggcaggactccttcttggtccctatatatgcgggagctttagtgcaccgg |
1524183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 124 - 206
Target Start/End: Complemental strand, 17048914 - 17048831
Alignment:
| Q |
124 |
tgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| |||||||| | ||||||||||||||| |||||| ||||||||||||| | ||| |||| |||||||||||| |
|
|
| T |
17048914 |
tgtaaaaaacagggtaaggttacgtacaatacaccaaaatggtggaaccccttcccggaacttgcttatgtaggagctttagtg |
17048831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 117 - 211
Target Start/End: Original strand, 25434049 - 25434144
Alignment:
| Q |
117 |
tctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg |
211 |
Q |
| |
|
||||||||| |||||| | ||||||| || ||||| |||||||| |||| ||| |||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
25434049 |
tctcttgtgcaaaaaacatggtaagagtgcatacaacacaccaaaatggtatgacttcttcttggaccctgcgtatgcgggagctttagtgcaccg |
25434144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 107 - 220
Target Start/End: Original strand, 27697457 - 27697572
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtggg--accccttcccg-gaccctgcatatgcgggagcttt |
202 |
Q |
| |
|
||||||||| |||||||||||||| |||| ||| ||||||| |||||||||| ||||||| |||| ||||| |||||||| ||||||||||||| |
|
|
| T |
27697457 |
ctggaaacaacctcttgtgtaaaaatcagggcaaggctgtgta--atacaccaaaatggtgggggaccctttccccagaccctgcgtatgcgggagctta |
27697554 |
T |
 |
| Q |
203 |
agtgcaccgggttgccct |
220 |
Q |
| |
|
| ||||||||| |||||| |
|
|
| T |
27697555 |
aatgcaccgggatgccct |
27697572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 164 - 222
Target Start/End: Original strand, 11888414 - 11888472
Alignment:
| Q |
164 |
gtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||| | |||||||| ||||| ||||||| ||||||| |||||||||||| |
|
|
| T |
11888414 |
gtgggacccctttctggaccctgtgtatgcaggagcttcagtgcactgggttgcccttt |
11888472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 108 - 220
Target Start/End: Original strand, 22065609 - 22065720
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||| ||| ||||||| | ||||| ||| |||||||||||| || || ||||| |||| ||||||| |
|
|
| T |
22065609 |
tggaaacaacctcttgtgtaaaa-atagggtaaagctgcatacaataaagcaaatagtgagaccccttcccgaactatgtgtatgcaggagttttagtgt |
22065707 |
T |
 |
| Q |
208 |
accgggttgccct |
220 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
22065708 |
accgggctgccct |
22065720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 94; Significance: 8e-46; HSPs: 70)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 24448910 - 24449027
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
24448910 |
ctggaaacagccttttgtgtaaaaaatagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtg |
24449009 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
24449010 |
caccgggttgcccttttt |
24449027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 107 - 223
Target Start/End: Original strand, 32703444 - 32703558
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32703444 |
ctggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
32703541 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
32703542 |
caccgggttgccctttt |
32703558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 107 - 223
Target Start/End: Original strand, 41014339 - 41014454
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| ||| ||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
41014339 |
ctggaaacagcctcttgtgtaaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcctggaccccgcatatgcgggagctttagtg |
41014437 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41014438 |
caccgggttgccctttt |
41014454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 107 - 223
Target Start/End: Original strand, 38879601 - 38879719
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||| ||||||| |||||||| ||| |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38879601 |
ctggaaacagcctcttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttag |
38879700 |
T |
 |
| Q |
205 |
tgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
38879701 |
tgcaccgggttgccctttt |
38879719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 4619221 - 4619103
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
||||||| || ||||||||||||||| |||||||| ||| |||||||||||||| |||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
4619221 |
ctggaaatagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttag |
4619122 |
T |
 |
| Q |
205 |
tgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4619121 |
tgcaccgggttgccctttt |
4619103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 107 - 225
Target Start/End: Complemental strand, 8170097 - 8169981
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| || |||||||||| | ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
8170097 |
ctggaaacagccttttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagtttcagtg |
8170000 |
T |
 |
| Q |
207 |
caccgggttgcccttttta |
225 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
8169999 |
caccgggttgcccttttta |
8169981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 107 - 222
Target Start/End: Complemental strand, 13801884 - 13801767
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||| ||| ||||||||||||||| |||||||| ||| |||||||||||||| |||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
13801884 |
ctggaagcagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttag |
13801785 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
13801784 |
tgcaccgggttgcccttt |
13801767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 35710333 - 35710448
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||| ||| || |||||||||||||||||||||||||||||||| | |||||||||||||||| ||||| |
|
|
| T |
35710333 |
ctggaaacagcctcttgtgtaaaa--tagggtaaggctgcgttcaatacaccaaatggtgggaccccttcccggaacatgcatatgcgggagctctagtg |
35710430 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
35710431 |
caccgggttgcccttttt |
35710448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 112 - 222
Target Start/End: Complemental strand, 16880757 - 16880647
Alignment:
| Q |
112 |
aacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccg |
211 |
Q |
| |
|
||||| ||||||||||||||| |||||||| ||| |||||||||||||||||||| |||| ||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
16880757 |
aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccg |
16880658 |
T |
 |
| Q |
212 |
ggttgcccttt |
222 |
Q |
| |
|
|||| |||||| |
|
|
| T |
16880657 |
ggtttcccttt |
16880647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 107 - 213
Target Start/End: Original strand, 43574626 - 43574732
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| ||||||||||| |||| |||||||| ||| |||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
43574626 |
ctggaaacaatctcttgtgtagaaaacagggtaaggctgcgtacaatataccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagag |
43574725 |
T |
 |
| Q |
207 |
caccggg |
213 |
Q |
| |
|
||||||| |
|
|
| T |
43574726 |
caccggg |
43574732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 107 - 219
Target Start/End: Original strand, 7368418 - 7368528
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
7368418 |
ctggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaattggtgggaccccttcccggaccctgcatatgtgggagctctagtg |
7368515 |
T |
 |
| Q |
207 |
caccgggttgccc |
219 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7368516 |
caccgggttgccc |
7368528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 146 - 223
Target Start/End: Original strand, 16957373 - 16957450
Alignment:
| Q |
146 |
tgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16957373 |
tgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
16957450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 107 - 221
Target Start/End: Original strand, 20135624 - 20135740
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||||||||||| | |||||| ||| |||||||||||||| |||||||||||||||||||||||| |||||||| ||||||| || |
|
|
| T |
20135624 |
ctggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttcag |
20135723 |
T |
 |
| Q |
205 |
tgcaccgggttgccctt |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
20135724 |
tgcaccgggttgccctt |
20135740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 134 - 222
Target Start/End: Complemental strand, 34154902 - 34154814
Alignment:
| Q |
134 |
agggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
34154902 |
agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgcccttt |
34154814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 107 - 223
Target Start/End: Original strand, 27328772 - 27328890
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacca--aatggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||| ||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
27328772 |
ctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccgaaccctgcgtatgcgggagctttaa |
27328871 |
T |
 |
| Q |
205 |
tgcaccgggttgccctttt |
223 |
Q |
| |
|
|||| ||| ||||| |||| |
|
|
| T |
27328872 |
tgcatcggattgccttttt |
27328890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 107 - 225
Target Start/End: Original strand, 43334222 - 43334342
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagcttta |
203 |
Q |
| |
|
|||||||||| ||| ||||||||||| |||||||| ||| ||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43334222 |
ctggaaacagcctcctgtgtaaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcg-atgcgggagcttta |
43334320 |
T |
 |
| Q |
204 |
gtgcaccgggttgcccttttta |
225 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
43334321 |
gtgcaccgggttgcccttttta |
43334342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 106 - 221
Target Start/End: Complemental strand, 12006446 - 12006329
Alignment:
| Q |
106 |
tctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagcttta |
203 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||| || ||||||||||||| |||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
12006446 |
tctggaaacaacctcttatgtaaaaaatagggtaaggctccatacaatacaccaataatggtgggaccccttcccagaccctgcctatgcgggagcttta |
12006347 |
T |
 |
| Q |
204 |
gtgcaccgggttgccctt |
221 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
12006346 |
gtgcaccgtgttgccctt |
12006329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 111 - 224
Target Start/End: Complemental strand, 24903807 - 24903694
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
|||||| || |||||||||||||||||||||| |||||||||| |||||| ||||| ||||||||||||||| ||||||| |||||| |||| ||||||| |
|
|
| T |
24903807 |
aaacagccttttgtgtaaaaaatagggtaagattgtgtacaatccaccaattggtgagaccccttcccggacactgcatacgcgggaactttggtgcacc |
24903708 |
T |
 |
| Q |
211 |
gggttgcccttttt |
224 |
Q |
| |
|
||| || ||||||| |
|
|
| T |
24903707 |
gggctgtccttttt |
24903694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 107 - 223
Target Start/End: Original strand, 29334415 - 29334532
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacca-aatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||||||| ||||||||||||||| | |||||| ||| ||||||||||||| ||||||||||||| |||||||||||||| |||| |||| ||||| | |
|
|
| T |
29334415 |
ctggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccagaatggtgggacccattcccggaccctgcgtatgtgggatctttaat |
29334514 |
T |
 |
| Q |
206 |
gcaccgggttgccctttt |
223 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
29334515 |
gcaccgggctgccctttt |
29334532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 1405207 - 1405324
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| ||||| | |||||||||| ||||| || |||||||||||||||||||||||||| |||| | |||||||||||||||||||| |||| |
|
|
| T |
1405207 |
ctggaaacaacctcttatataaaaaatagagtaagtttgcgtacaatacaccaaatggtgggaccctttcctgaaccctgcatatgcgggagctctagta |
1405306 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
1405307 |
caccggattgcccttttt |
1405324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 19143057 - 19142941
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| ||| ||||| ||||||||||||||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
19143057 |
ctggaaacaacctcttgtgtaaaaac-agggtaaggctgcgtacagtacaccaaatggtgggaccccttcccggaccatgcgtatgcgggagatttagtg |
19142959 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
||| || |||||||||| |
|
|
| T |
19142958 |
cactggcctgcccttttt |
19142941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 127 - 223
Target Start/End: Original strand, 3771379 - 3771475
Alignment:
| Q |
127 |
aaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||||| |||||||| ||||| |||||||||||| ||||||||||||||||||||| ||| |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
3771379 |
aaaaaacagggtaaggctgtgaacaatacaccaattggtgggaccccttcccggactctgtgtatgtgggagctttagtgcaccgggctgccctttt |
3771475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 111 - 210
Target Start/End: Complemental strand, 7097870 - 7097772
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
|||||| |||||||||||||| |||||||| || |||||||||||||||||||| |||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
7097870 |
aaacagcctcttgtgtaaaaac-agggtaaggttgcgtacaatacaccaaatggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcacc |
7097772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 107 - 202
Target Start/End: Original strand, 22600474 - 22600569
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt |
202 |
Q |
| |
|
||||||||| | | |||||||||| | |||||||| ||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||| |
|
|
| T |
22600474 |
ctggaaacaatattttgtgtaaaacacagggtaaggctgtgtacaatacaccaaatggtgggatcccttcccggatcctgcgtatgcgggagcttt |
22600569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 108 - 222
Target Start/End: Complemental strand, 5873435 - 5873322
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||| || ||||| |||||||| ||||||||| ||| ||||||| |||| ||||||||||||||||||| |
|
|
| T |
5873435 |
tggaaacagcctcttgtgtaaaaa-tagggtaaggctaagtacactacaccaattggtgggactcctccccggacactgcgtatgcgggagctttagtgc |
5873337 |
T |
 |
| Q |
208 |
accgggttgcccttt |
222 |
Q |
| |
|
| |||| |||||||| |
|
|
| T |
5873336 |
atcgggatgcccttt |
5873322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 163 - 224
Target Start/End: Complemental strand, 16028683 - 16028622
Alignment:
| Q |
163 |
ggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16028683 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttt |
16028622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 138 - 222
Target Start/End: Original strand, 1565483 - 1565566
Alignment:
| Q |
138 |
taagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||| ||| ||||||| |||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
1565483 |
taaggctgcgtacaatgcaccaaatggcgggaccccttcccggaccctgcatatgtgggagc-ttagtgcaccgggttgcccttt |
1565566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 160 - 222
Target Start/End: Original strand, 25622533 - 25622595
Alignment:
| Q |
160 |
aatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
25622533 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt |
25622595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 134 - 218
Target Start/End: Original strand, 30006372 - 30006456
Alignment:
| Q |
134 |
agggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcc |
218 |
Q |
| |
|
|||||||| ||||||||| ||||| |||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
30006372 |
agggtaaggctgtgtacattacactaaatggtgggaccccttcccggggcctatgtatgcgggagctttagtgcaccgggttgcc |
30006456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 114 - 223
Target Start/End: Complemental strand, 22861774 - 22861668
Alignment:
| Q |
114 |
cagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggg |
213 |
Q |
| |
|
||||||||||||||||| | ||||||||| |||||||| ||||||||||||||||||| || |||||||||||||||||||| |||||||||| |
|
|
| T |
22861774 |
cagtctcttgtgtaaaacaa---gtaagactgctcacaatacatcaaatggtgggaccccttctcgaaccctgcatatgcgggagctctagtgcaccgaa |
22861678 |
T |
 |
| Q |
214 |
ttgccctttt |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
22861677 |
ttgccctttt |
22861668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 163 - 222
Target Start/End: Complemental strand, 30877623 - 30877564
Alignment:
| Q |
163 |
ggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
30877623 |
ggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcccttt |
30877564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 110 - 199
Target Start/End: Original strand, 2838802 - 2838890
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagc |
199 |
Q |
| |
|
||||||| ||||||||||||| |||||||| ||| ||||||||||||||||||||||| |||||| |||||||||| ||||||||||| |
|
|
| T |
2838802 |
gaaacagcatcttgtgtaaaaac-agggtaaggctgcgtacaatacaccaaatggtgggatcccttctcggaccctgcgtatgcgggagc |
2838890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 107 - 222
Target Start/End: Complemental strand, 12575777 - 12575660
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaa-aaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| |||||| ||||| ||| ||| ||| || ||||||||||||||| |||||||||||||||| ||||||||| ||||| |||||||| | |
|
|
| T |
12575777 |
ctggaaacagcctcttgcgtaaataaacaggctaaagttgcgtacaatacaccaaaatggtgggaccccttcctggaccctgcgtatgcaggagctttgg |
12575678 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttt |
222 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
12575677 |
tgcaccgggctgcccttt |
12575660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 152 - 224
Target Start/End: Complemental strand, 10943914 - 10943843
Alignment:
| Q |
152 |
atacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
10943914 |
atacaccaaataacgggaccccttcccggaccctgca-atgcgggagctttagtgcaccgggctgcccttttt |
10943843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 106 - 202
Target Start/End: Complemental strand, 24323821 - 24323725
Alignment:
| Q |
106 |
tctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt |
202 |
Q |
| |
|
|||||||||| ||||||||||||| | |||||||| || ||| ||||| |||||| ||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
24323821 |
tctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatagtgggaccccttcccagaccctgtatatgcgggagcttt |
24323725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 106 - 202
Target Start/End: Complemental strand, 24360445 - 24360349
Alignment:
| Q |
106 |
tctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt |
202 |
Q |
| |
|
|||||||||| ||||||||||||| | |||||||| || ||| ||||| |||||| ||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
24360445 |
tctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatagtgggaccccttcccagaccctgtatatgcgggagcttt |
24360349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 108 - 223
Target Start/End: Complemental strand, 28516548 - 28516432
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||| ||||||||||||||| ||| || | ||| |||||||||| |||| ||||||||||| ||||| |||||||| |||| |||||||||||| |
|
|
| T |
28516548 |
tggaaacatcctcttgtgtaaaaaacaggctagggctgcgtacaatacatcaaaatggtgggacccattcccagaccctgcgcatgcaggagctttagtg |
28516449 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
28516448 |
gaccaggttgccctttt |
28516432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 107 - 222
Target Start/End: Original strand, 22187305 - 22187422
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||||||||||| | | |||||||| |||||||||||| ||| || ||||||||||| ||||| ||||||| |||||||||| |
|
|
| T |
22187305 |
ctggaaacagcctcttgtgtaaaaaacatgataagactgcgtacaatacaccaaaaacaatgagaccccttcccaaaccctacatatgcaggagctttag |
22187404 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttt |
222 |
Q |
| |
|
|||| | ||||||||||| |
|
|
| T |
22187405 |
tgcatcaggttgcccttt |
22187422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 148 - 224
Target Start/End: Complemental strand, 11657774 - 11657697
Alignment:
| Q |
148 |
tacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||| | |||||| ||||||| ||||||| |||||||||| |
|
|
| T |
11657774 |
tacaatacaccaaaatggtgggaccccttcccgaaccctgcacacgcgggaactttagttcaccgggctgcccttttt |
11657697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 128 - 224
Target Start/End: Complemental strand, 37226056 - 37225959
Alignment:
| Q |
128 |
aaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||| |||||||| ||||||||||||| |||| |||||||||||||||||| ||| ||| ||||| ||| |||||||||| || ||||||||||| |
|
|
| T |
37226056 |
aaaaattgggtaagaatgtgtacaatacaacaaaatggtgggaccccttcccgaaccatgcgtatgccagaggtttagtgcactggattgcccttttt |
37225959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 162 - 223
Target Start/End: Original strand, 39801591 - 39801652
Alignment:
| Q |
162 |
tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||| |||||| | |||||||||||||||||||||||||||||| |||| |
|
|
| T |
39801591 |
tggtgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgccatttt |
39801652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 149 - 213
Target Start/End: Original strand, 13774927 - 13774991
Alignment:
| Q |
149 |
acaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggg |
213 |
Q |
| |
|
|||||||||||||||| ||| ||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13774927 |
acaatacaccaaatggcaggatccctttccggaccctgcgtatgcgggagctttagtgcaccggg |
13774991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 159 - 219
Target Start/End: Complemental strand, 21784395 - 21784335
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccc |
219 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||| |||||||||||| ||||||| |
|
|
| T |
21784395 |
aaatggtgggacccctttccggaccctgcgtatgcgggaggtttagtgcaccgagttgccc |
21784335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 171 - 223
Target Start/End: Original strand, 32354211 - 32354263
Alignment:
| Q |
171 |
cccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32354211 |
cccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccctttt |
32354263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 129 - 212
Target Start/End: Complemental strand, 9794471 - 9794388
Alignment:
| Q |
129 |
aaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg |
212 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||| |||||| |||||| | ||||| |||||||| | |||||||||||||||| |
|
|
| T |
9794471 |
aaaacagggtaagactgcatacaatacaccaaatagtgggatcccttcacagacccagcatatgcagaagctttagtgcaccgg |
9794388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 149 - 203
Target Start/End: Complemental strand, 10306548 - 10306493
Alignment:
| Q |
149 |
acaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagcttta |
203 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10306548 |
acaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagcttta |
10306493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 1850699 - 1850764
Alignment:
| Q |
147 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg |
212 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||||||| |||||| |||||||||||||||| |
|
|
| T |
1850699 |
gtacaatacatcaaatggtgggaccacttcctggaccctgcggatgcggaagctttagtgcaccgg |
1850764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 111 - 208
Target Start/End: Original strand, 18426063 - 18426160
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgca |
208 |
Q |
| |
|
||||| ||||||||||||||||||| | ||| ||||||||||||| | ||||||| |||||||| || || |||| |||||| ||||||||||||| |
|
|
| T |
18426063 |
aaacaatctcttgtgtaaaaaatagagaaaggttgtgtacaatacatcgaatggtgagaccccttttcgaactctgcgtatgcgagagctttagtgca |
18426160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 118 - 213
Target Start/End: Complemental strand, 209031 - 208936
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggg |
213 |
Q |
| |
|
|||||||||||||| |||||||| ||| | |||||||||||| |||||||||||||||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
209031 |
ctcttgtgtaaaaac-agggtaaggctgcattcaatacaccaaaatggtgggaccccttcctggaccctgggtatgcaagagctttagtgcaccggg |
208936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 159 - 210
Target Start/End: Complemental strand, 4654478 - 4654427
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
4654478 |
aaatggtgggatcccttctcgaaccctgcatatgcgggagctttagtgcacc |
4654427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 144 - 218
Target Start/End: Complemental strand, 39079830 - 39079755
Alignment:
| Q |
144 |
tgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcc |
218 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| || ||| |||||| |||||||||| ||| |||| |
|
|
| T |
39079830 |
tgtgtacaatacaccaaaatggtgggaccccttcccggaccatgtgtatacgggagttttagtgcacagggctgcc |
39079755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 121 - 187
Target Start/End: Original strand, 41425982 - 41426048
Alignment:
| Q |
121 |
ttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgc |
187 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||||||||| ||||||||||||||||| ||| |||| |
|
|
| T |
41425982 |
ttgtgtaaaaaacagggtaaggctgcatacaatacaccaattggtgggaccccttcccagactctgc |
41426048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 138 - 210
Target Start/End: Complemental strand, 12477205 - 12477132
Alignment:
| Q |
138 |
taagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
|||| ||| ||||||||||||||| |||||||||||||||||||| |||| ||||| ||||||||||||||| |
|
|
| T |
12477205 |
taaggctgcgtacaatacaccaaaatggtgggaccccttcccggattctgcgtatgcaagagctttagtgcacc |
12477132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 159 - 224
Target Start/End: Original strand, 19093885 - 19093950
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||| ||||||| |||||||||||| |||| ||||||||||||||||||| |||||||||| |
|
|
| T |
19093885 |
aaatggtatgacccctacccggaccctgcgtatgttggagctttagtgcaccgggctgcccttttt |
19093950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 119 - 222
Target Start/End: Complemental strand, 42924937 - 42924830
Alignment:
| Q |
119 |
tcttgtgtaaaaaatagggtaagactgtgtacaatacacc--aaatggtgggaccccttcccgg--accctgcatatgcgggagctttagtgcaccgggt |
214 |
Q |
| |
|
|||||||||||||| |||||||| || |||||||||||| ||||| ||| | |||||||| | ||||||| ||||||| |||||||||||||||| | |
|
|
| T |
42924937 |
tcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaaaatgatggaatcccttcccagacaccctgcgtatgcggaagctttagtgcaccggat |
42924838 |
T |
 |
| Q |
215 |
tgcccttt |
222 |
Q |
| |
|
|| ||||| |
|
|
| T |
42924837 |
tgtccttt |
42924830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 118 - 213
Target Start/End: Original strand, 39301154 - 39301249
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaat-ggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggg |
213 |
Q |
| |
|
|||||||||| |||| |||||||| || ||| ||| ||||||| ||||||||||||||||||||||| | |||| ||||| |||||||||||||| |
|
|
| T |
39301154 |
ctcttgtgtataaaacagggtaaggatgcgtataatgcaccaaaaaggtgggaccccttcccggaccctccgtatgtgggag-tttagtgcaccggg |
39301249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 221
Target Start/End: Original strand, 19438757 - 19438800
Alignment:
| Q |
178 |
cggaccctgcatatgcgggagctttagtgcaccgggttgccctt |
221 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
19438757 |
cggaccctgcatatgcgggagctctagtgcaccaggttgccctt |
19438800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 157 - 200
Target Start/End: Complemental strand, 21542532 - 21542489
Alignment:
| Q |
157 |
ccaaatggtgggaccccttcccggaccctgcatatgcgggagct |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
21542532 |
ccaaatggtgggaccccttcccggactctgcgtatgcgggagct |
21542489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 210
Target Start/End: Complemental strand, 31694207 - 31694120
Alignment:
| Q |
123 |
gtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
|||||||||||||| ||| ||| ||||||||||| | || |||||| ||||||| |||| ||| |||||||||| ||||||||||| |
|
|
| T |
31694207 |
gtgtaaaaaataggctaaagctgcatacaatacacctattgatgggactccttcccagaccttgcgtatgcgggagatttagtgcacc |
31694120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 143 - 205
Target Start/End: Original strand, 15141936 - 15141998
Alignment:
| Q |
143 |
ctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| | ||||||| ||| ||||||||||||| |
|
|
| T |
15141936 |
ctgtgtgcaatacatcaaatggtgggaccccttcttgaaccctgcttatacgggagctttagt |
15141998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 175 - 220
Target Start/End: Original strand, 11462913 - 11462958
Alignment:
| Q |
175 |
tcccggaccctgcatatgcgggagctttagtgcaccgggttgccct |
220 |
Q |
| |
|
||||| || ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11462913 |
tcccgaactctgcatatgcgggagctctagtgcaccgggttgccct |
11462958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 180 - 221
Target Start/End: Complemental strand, 29184103 - 29184062
Alignment:
| Q |
180 |
gaccctgcatatgcgggagctttagtgcaccgggttgccctt |
221 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29184103 |
gaccatgcgtatgcgggagctttagtgcaccgggttgccctt |
29184062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 110 - 213
Target Start/End: Complemental strand, 34074674 - 34074573
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
209 |
Q |
| |
|
||||||| ||||||||||||||| | ||||| || || ||||||||||||||| || ||||||||| ||||||| |||| |||||| |||||||| |
|
|
| T |
34074674 |
gaaacagcctcttgtgtaaaaaacacagtaaggttgcgttcaatacaccaaatggcagggccccttcccaaaccctgcgtatgggggagc--tagtgcac |
34074577 |
T |
 |
| Q |
210 |
cggg |
213 |
Q |
| |
|
|||| |
|
|
| T |
34074576 |
cggg |
34074573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 181 - 224
Target Start/End: Original strand, 18099955 - 18099998
Alignment:
| Q |
181 |
accctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
18099955 |
accctgcgtatgcgggagctttagtgcactgggtttcccttttt |
18099998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 150 - 223
Target Start/End: Complemental strand, 24313646 - 24313571
Alignment:
| Q |
150 |
caatacaccaaa-tggtgggaccccttcccggaccc-tgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| || || ||||| | ||||||||||||||||| ||||||||| |
|
|
| T |
24313646 |
caatacaccaaaatggtgggaccccttcccggcgccatgtgtatgctgtagctttagtgcaccgggctgccctttt |
24313571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 150 - 223
Target Start/End: Complemental strand, 24355983 - 24355908
Alignment:
| Q |
150 |
caatacaccaaa-tggtgggaccccttcccggaccc-tgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| || || ||||| | ||||||||||||||||| ||||||||| |
|
|
| T |
24355983 |
caatacaccaaaatggtgggaccccttcccggcgccatgtgtatgctgtagctttagtgcaccgggctgccctttt |
24355908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 175 - 217
Target Start/End: Original strand, 18684361 - 18684403
Alignment:
| Q |
175 |
tcccggaccctgcatatgcgggagctttagtgcaccgggttgc |
217 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
18684361 |
tcccagaccctgcgtatgcgggagctttagtgcatcgggttgc |
18684403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 210
Target Start/End: Original strand, 29297864 - 29297914
Alignment:
| Q |
160 |
aatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
|||||||||| |||||||||||||| ||| || |||| ||||||||||||| |
|
|
| T |
29297864 |
aatggtgggatcccttcccggaccccgcaaatacgggtgctttagtgcacc |
29297914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 147 - 209
Target Start/End: Complemental strand, 3176829 - 3176770
Alignment:
| Q |
147 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
209 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
3176829 |
gtacaatacaccaactggtgggaccc---cccggactctgtgtatgccggagctttagtgcac |
3176770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 110 - 174
Target Start/End: Complemental strand, 22907976 - 22907913
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggacccct |
174 |
Q |
| |
|
||||||| |||||||||||||| || ||||| || ||||||||||||||||||||||||||| |
|
|
| T |
22907976 |
gaaacagcctcttgtgtaaaaac-agagtaaggttgcatacaatacaccaaatggtgggacccct |
22907913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 94; Significance: 8e-46; HSPs: 84)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 40272927 - 40272810
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40272927 |
ctggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg |
40272828 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
40272827 |
caccgggttgcccttttt |
40272810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 13730719 - 13730600
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13730719 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttag |
13730620 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
13730619 |
tgcaccgggttgcccttttt |
13730600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 107 - 225
Target Start/End: Original strand, 54484732 - 54484851
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||||||| ||||||||||||||| | |||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54484732 |
ctggaaacagcctcttgtgtaaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagt |
54484831 |
T |
 |
| Q |
206 |
gcaccgggttgcccttttta |
225 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
54484832 |
gcaccgggttgcccttttta |
54484851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 107 - 225
Target Start/End: Original strand, 1217132 - 1217248
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||| ||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1217132 |
ctggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggcgggaccccttcccggaccctgcatatgcgggagctctagtg |
1217229 |
T |
 |
| Q |
207 |
caccgggttgcccttttta |
225 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1217230 |
caccgggttgcccttttta |
1217248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 13628907 - 13628789
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||||||| ||| |||||||| ||| |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13628907 |
ctggaaacagcctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttag |
13628808 |
T |
 |
| Q |
205 |
tgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
13628807 |
tgcaccgggttgccctttt |
13628789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 107 - 221
Target Start/End: Complemental strand, 22123030 - 22122918
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
22123030 |
ctggaaacagtctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgagagctctagtg |
22122933 |
T |
 |
| Q |
207 |
caccgggttgccctt |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
22122932 |
caccgggttgccctt |
22122918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 108 - 224
Target Start/End: Complemental strand, 49013589 - 49013471
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| ||| |||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
49013589 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagt |
49013490 |
T |
 |
| Q |
206 |
gcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
49013489 |
gcaccgggttgcccttttt |
49013471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 12914150 - 12914034
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| | | |||||||||||||||||||| ||||||||||| |||||||||||||||||||||| | || |
|
|
| T |
12914150 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggcggcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgcgggagcttcaatg |
12914051 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
12914050 |
caccgggttgccctttt |
12914034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 107 - 222
Target Start/End: Original strand, 31592891 - 31593004
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||| ||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31592891 |
ctggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggactccttcccggaccctgcatatgcgggagctctagtg |
31592988 |
T |
 |
| Q |
207 |
caccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
31592989 |
caccgggttgcccttt |
31593004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 107 - 222
Target Start/End: Original strand, 14986999 - 14987116
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| ||| |||||||||||||| |||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
14986999 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcgggagctttag |
14987098 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttt |
222 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
14987099 |
tgcaccgggtttcccttt |
14987116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 108 - 221
Target Start/End: Original strand, 22609809 - 22609921
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| ||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
22609809 |
tggaaacagcctcttgtgtaaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgc |
22609907 |
T |
 |
| Q |
208 |
accgggttgccctt |
221 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
22609908 |
accgggttgccctt |
22609921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 110 - 222
Target Start/End: Original strand, 39203561 - 39203671
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
209 |
Q |
| |
|
||||||| ||||||||||||| | ||||||| || ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39203561 |
gaaacagcctcttgtgtaaaaca--gggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccttgcatatgcgggagctttagtgcac |
39203658 |
T |
 |
| Q |
210 |
cgggttgcccttt |
222 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39203659 |
cgggttgcccttt |
39203671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 46421152 - 46421032
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagcttt-a |
203 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| ||| |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
46421152 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttaa |
46421053 |
T |
 |
| Q |
204 |
gtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
46421052 |
gtgcaccggtttgcccttttt |
46421032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 129 - 225
Target Start/End: Complemental strand, 34771457 - 34771361
Alignment:
| Q |
129 |
aaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttta |
225 |
Q |
| |
|
|||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
34771457 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgcccttttta |
34771361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 129 - 224
Target Start/End: Original strand, 15797284 - 15797379
Alignment:
| Q |
129 |
aaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
15797284 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcccttttt |
15797379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 29366837 - 29366719
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||| ||||||| |||||||| ||| |||||||||||||| ||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
29366837 |
ctggaaacagcctcttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgtgggagctttag |
29366738 |
T |
 |
| Q |
205 |
tgcaccgggttgccctttt |
223 |
Q |
| |
|
||||| ||||||||||||| |
|
|
| T |
29366737 |
tgcactgggttgccctttt |
29366719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 111 - 222
Target Start/End: Complemental strand, 45786327 - 45786214
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttagtgca |
208 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||| ||||||||||||||| |||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
45786327 |
aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgca |
45786228 |
T |
 |
| Q |
209 |
ccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45786227 |
ccgggttgcccttt |
45786214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 26869749 - 26869865
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||||| ||| ||||||||||||||||||||||||||||| ||||||| ||| |||||||||||||| ||| |
|
|
| T |
26869749 |
ctggaaacagcctctggtgtaaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttgccggaccatgcgtatgcgggagctttggtg |
26869847 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
26869848 |
caccgggttgcccttttt |
26869865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 107 - 212
Target Start/End: Complemental strand, 45948953 - 45948848
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||| ||||||||||||| ||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
45948953 |
ctggaaacaacctcttgtgtaaaaaatagggtaaggctgcatacaatacaccaattggtgggaccccttctcggaccctgcgtatgcgggagctttagtg |
45948854 |
T |
 |
| Q |
207 |
caccgg |
212 |
Q |
| |
|
|||||| |
|
|
| T |
45948853 |
caccgg |
45948848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 108 - 224
Target Start/End: Complemental strand, 54374460 - 54374343
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||| ||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54374460 |
tggaaacaacctcttgtgtaaaaaatagggtaaggctgcgtacaatccaccaaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtt |
54374361 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||| || |||| ||||| |
|
|
| T |
54374360 |
caccaggctgccattttt |
54374343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 123 - 220
Target Start/End: Complemental strand, 353450 - 353351
Alignment:
| Q |
123 |
gtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccct |
220 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
353450 |
gtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
353351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 516451 - 516571
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa---tggtgggaccccttcccggaccctgcatatgcgggagcttta |
203 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| ||| | |||||| |||||| ||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
516451 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgcacaataaaccaaaaaatggcgggaccccttccccgaccctgcgtatgcgggagcttta |
516550 |
T |
 |
| Q |
204 |
gtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
516551 |
gtgcaccgggttgcccttttt |
516571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 107 - 222
Target Start/End: Complemental strand, 10795540 - 10795423
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||||||||| | |||||||| ||| ||||||||||||||| |||||||||||||||| ||||||||| ||||||||||||| || |
|
|
| T |
10795540 |
ctggaaacagcctcttgtgtaaaagacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcag |
10795441 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
10795440 |
tgcaccaggttgcccttt |
10795423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 107 - 220
Target Start/End: Original strand, 26573169 - 26573282
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||| ||||||||||| |||||||| ||| |||||||||||||| |||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
26573169 |
ctggaaacagcctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaattggtgggaccccatcccggaccctgcgtatgcgtgagctttagtg |
26573268 |
T |
 |
| Q |
207 |
caccgggttgccct |
220 |
Q |
| |
|
|||| || |||||| |
|
|
| T |
26573269 |
caccaggctgccct |
26573282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 107 - 225
Target Start/End: Complemental strand, 34420759 - 34420640
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| ||| |||| |||||||||| |||||||||||||||||||||| ||| |||| |||||||||||| |
|
|
| T |
34420759 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtaccatacaccaaaatggtgggaccccttcccggaccttgcgtatgtgggagctttagt |
34420660 |
T |
 |
| Q |
206 |
gcaccgggttgcccttttta |
225 |
Q |
| |
|
|||| || ||||||||||| |
|
|
| T |
34420659 |
gcacatggctgcccttttta |
34420640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 137 - 224
Target Start/End: Complemental strand, 52926304 - 52926217
Alignment:
| Q |
137 |
gtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52926304 |
gtaaggctgcgtacaatacaccaaatggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgcccttttt |
52926217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 108 - 225
Target Start/End: Complemental strand, 53996680 - 53996562
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||| ||| |||||||||||||| ||||||||||||||||| ||| |||| |||| ||||||||||||| |
|
|
| T |
53996680 |
tggaaacaacctcttgtgtaaaaaacagggtaaggctgcttacaatacaccaaaatggtgggaccccttccctgacactgcgtatgtgggagctttagtg |
53996581 |
T |
 |
| Q |
207 |
caccgggttgcccttttta |
225 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
53996580 |
caccgggctgcccttttta |
53996562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 7943032 - 7943149
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||| ||||||| |||||||||||| |||||||||| |||||||||||| ||||| || |||| ||| |||||||||||||||||| |
|
|
| T |
7943032 |
ctggaaacagcatcttgtctaaaaaacagggtaagactgcgtacaatacatcaaatggtgggatccctttccagaccatgcgtatgcgggagctttagtg |
7943131 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
||| |||||||| ||||| |
|
|
| T |
7943132 |
cactgggttgcctttttt |
7943149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 107 - 220
Target Start/End: Complemental strand, 8247804 - 8247688
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagcttt-a |
203 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| || |||||||||||||| |||||||||| |||||||||||||||| |||||||||||||| | |
|
|
| T |
8247804 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggactccttcccggaccctgcgtatgcgggagctttaa |
8247705 |
T |
 |
| Q |
204 |
gtgcaccgggttgccct |
220 |
Q |
| |
|
|||||| |||||||||| |
|
|
| T |
8247704 |
gtgcactgggttgccct |
8247688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 156 - 224
Target Start/End: Complemental strand, 24851367 - 24851299
Alignment:
| Q |
156 |
accaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24851367 |
accaaatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgcccttttt |
24851299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 128 - 223
Target Start/End: Original strand, 16735503 - 16735598
Alignment:
| Q |
128 |
aaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
||||| |||||||| ||| |||||||||||||||||||||||||||||||||||| |||| ||||||| ||||| ||||||| ||||||||||||| |
|
|
| T |
16735503 |
aaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgccctttt |
16735598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 25517286 - 25517169
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||| ||||||||||||||| | | || | ||| ||||||||||| ||||||||||||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
25517286 |
ctggaaacatcctcttgtgtaaaaaaacaagatatggctgcgtacaatacacaaaatggtgggaccccttcccggatcctgcgtatgctggagctttagt |
25517187 |
T |
 |
| Q |
206 |
gcaccgggttgccctttt |
223 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
25517186 |
gcaccgggttgccctttt |
25517169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 111 - 211
Target Start/End: Complemental strand, 6411932 - 6411833
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
|||||| |||||||||||||| |||||||| ||| ||||||||||||||||| |||||||||||||| |||| ||| |||||||||||||||||||||| |
|
|
| T |
6411932 |
aaacagcctcttgtgtaaaaac-agggtaaggctgcgtacaatacaccaaatgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcacc |
6411834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 107 - 206
Target Start/End: Original strand, 33926125 - 33926224
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacca-aatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||| || |||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
33926125 |
ctggaaatagcctcttgtgtaaaaac-agggtaaggctgtgtacaatacaccataatggtgggaccccttcctggaccctgcatatgcgagagctttagt |
33926223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 107 - 202
Target Start/End: Complemental strand, 30928262 - 30928167
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt |
202 |
Q |
| |
|
|||||||||| ||||||||||||||| | |||||| |||||| |||||||||| ||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30928262 |
ctggaaacagcctcttgtgtaaaaaacaaggtaaggttgtgtaaaatacaccaattggcgggaccccttcccggaccctgcatatgtgggagcttt |
30928167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 162 - 223
Target Start/End: Original strand, 30452892 - 30452953
Alignment:
| Q |
162 |
tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30452892 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
30452953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 118 - 222
Target Start/End: Original strand, 9276317 - 9276419
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgc |
217 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||| |||||| |||||||||||||| ||||||||| ||||| ||| | ||||||| |
|
|
| T |
9276317 |
ctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggt-ggaccctttcccggaccctgcgtatgcgggaacttta-tgcgcagggttgc |
9276414 |
T |
 |
| Q |
218 |
ccttt |
222 |
Q |
| |
|
||||| |
|
|
| T |
9276415 |
ccttt |
9276419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 129 - 225
Target Start/End: Original strand, 26292394 - 26292490
Alignment:
| Q |
129 |
aaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttta |
225 |
Q |
| |
|
|||| |||||||||| | |||| |||||||||||| ||||| ||||||||| ||||||||||||||||| || ||||||||||||||| |||||||| |
|
|
| T |
26292394 |
aaaacagggtaagaccgcgtacgatacaccaaatgatgggatcccttcccgaaccctgcatatgcgggaactctagtgcaccgggttgtccttttta |
26292490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 107 - 221
Target Start/End: Complemental strand, 7697000 - 7696893
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| ||| |||||||||||||||||| ||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
7697000 |
ctggaaacagtctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatgg-----ccccttcccggacactgcatatgtgggagctctagtg |
7696908 |
T |
 |
| Q |
207 |
caccgggttgccctt |
221 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
7696907 |
caccgggtttccctt |
7696893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 25944511 - 25944629
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||||| | |||| |||||||||| ||| ||| ||| ||||||||||||||| ||||||||||||||||| |||||||| |||| ||||||||||| |
|
|
| T |
25944511 |
ctggaaaccgcctctcgtgtaaaaaactgggcaaggctgagtacaatacaccaaaatggtgggaccccttccctgaccctgcgtatgtgggagctttagc |
25944610 |
T |
 |
| Q |
206 |
gcaccgggttgcccttttt |
224 |
Q |
| |
|
||||| || |||||||||| |
|
|
| T |
25944611 |
gcaccaggctgcccttttt |
25944629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 159 - 224
Target Start/End: Complemental strand, 5173782 - 5173717
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||| |||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173782 |
aaatggtggggccccttcccggaccttgcgtatgcgggagctttagtgcaccgggttgcccttttt |
5173717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 107 - 205
Target Start/End: Original strand, 9607245 - 9607345
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| |||||| |||||||| |||||||| ||| ||| |||||||||| ||| |||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
9607245 |
ctggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtagaatacaccaataatgttgggaccccttcccagaccccgcatatgcgggagctttag |
9607344 |
T |
 |
| Q |
205 |
t |
205 |
Q |
| |
|
| |
|
|
| T |
9607345 |
t |
9607345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 118 - 221
Target Start/End: Original strand, 33235584 - 33235687
Alignment:
| Q |
118 |
ctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttg |
216 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| || | |||| | | ||||||| |||||||||||||| ||||| |
|
|
| T |
33235584 |
ctcttgtgtaaaaaaacagggtaagactgtgtacaatacactaaatggtgggacccc-tcgcagaccttacgtatgcggaagctttagtgcaccaggttg |
33235682 |
T |
 |
| Q |
217 |
ccctt |
221 |
Q |
| |
|
||||| |
|
|
| T |
33235683 |
ccctt |
33235687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 111 - 218
Target Start/End: Original strand, 55401222 - 55401330
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
209 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||||||| ||| ||||||||||| ||||||||||||||| |||||| | | |||||||||||||| ||||| |
|
|
| T |
55401222 |
aaacagcctcttgtgtaaaaaacaggttaagactgcgtataatacaccaaaatggtgggaccccttctcggaccttccgtatgcgggagcttttttgcac |
55401321 |
T |
 |
| Q |
210 |
cgggttgcc |
218 |
Q |
| |
|
|||| |||| |
|
|
| T |
55401322 |
cgggctgcc |
55401330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 112 - 222
Target Start/End: Original strand, 28904990 - 28905100
Alignment:
| Q |
112 |
aacagtctcttgtgtaaaa-aatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
||||||||||||||||||| || | |||||||||||||||| |||||||||| |||||||| |||||||||||||| || |||||| |||||||| | | |
|
|
| T |
28904990 |
aacagtctcttgtgtaaaataacaaggtaagactgtgtacattacaccaaata-tgggaccctttcccggaccctgcgtaagcgggaactttagtgtaac |
28905088 |
T |
 |
| Q |
211 |
gggttgcccttt |
222 |
Q |
| |
|
||| |||||||| |
|
|
| T |
28905089 |
gggctgcccttt |
28905100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 107 - 221
Target Start/End: Complemental strand, 31904972 - 31904857
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtggga-ccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||||||| || || ||||||||| |||||| ||||| ||||||||||||||||||||||| ||||||||| || | | | | ||||||||||||||| |
|
|
| T |
31904972 |
ctggaaacagcctattatgtaaaaaacagggtatgactgcgtacaatacaccaaatggtgggacccccttcccagatcttacgtgtgcgggagctttagt |
31904873 |
T |
 |
| Q |
206 |
gcaccgggttgccctt |
221 |
Q |
| |
|
||||| || ||||||| |
|
|
| T |
31904872 |
gcaccaggctgccctt |
31904857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 111 - 186
Target Start/End: Original strand, 47624088 - 47624162
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctg |
186 |
Q |
| |
|
|||||| |||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47624088 |
aaacagcctcttgtgtaaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
47624162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 110 - 224
Target Start/End: Complemental strand, 50625065 - 50624951
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
209 |
Q |
| |
|
||||||| |||||||||| |||| |||||||| | ||||||||||||| ||||||||| |||||| || |||||| || | |||||||||||||||| |
|
|
| T |
50625065 |
gaaacagcctcttgtgtataaaaaagggtaaggtagcgtacaatacaccatttggtgggacgccttcctgggccctgcgtaagtgggagctttagtgcac |
50624966 |
T |
 |
| Q |
210 |
cgggttgcccttttt |
224 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
50624965 |
cgggctgcccttttt |
50624951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 147 - 224
Target Start/End: Original strand, 24577917 - 24577994
Alignment:
| Q |
147 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||| ||||||||||| || ||||| |||||||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
24577917 |
gtacaatacactaaatggtgggatcctttcccagaccctgcatatacgggagctctagtgcaccggattgcccttttt |
24577994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 147 - 224
Target Start/End: Original strand, 24578007 - 24578084
Alignment:
| Q |
147 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||| |||||||||||| | ||||| |||||| ||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
24578007 |
gtacaatacactaaatggtgggactctttcccagaccctacatatgcgggaactctagtgcaccgggttgcccttttt |
24578084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 167 - 223
Target Start/End: Complemental strand, 10484671 - 10484615
Alignment:
| Q |
167 |
ggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10484671 |
ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
10484615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 107 - 218
Target Start/End: Original strand, 19731044 - 19731155
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||| || ||||||||||||||| | |||||| || |||||||||||| | ||||||||||| ||||| ||| ||| ||||| |||||||||||| |
|
|
| T |
19731044 |
ctggaaatagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacacctattggtgggaccctttcccagactctgtgtatgcaggagctttagtg |
19731143 |
T |
 |
| Q |
207 |
caccgggttgcc |
218 |
Q |
| |
|
||||||| |||| |
|
|
| T |
19731144 |
caccgggctgcc |
19731155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 829518 - 829452
Alignment:
| Q |
147 |
gtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||| ||||| |||||||||||||||||| |
|
|
| T |
829518 |
gtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgcaccgg |
829452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 121 - 224
Target Start/End: Complemental strand, 4495765 - 4495674
Alignment:
| Q |
121 |
ttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccct |
220 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4495765 |
ttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccc------------tgcgtatgcgggagctttagtgcaccgggttgccct |
4495678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 174 - 224
Target Start/End: Original strand, 47624208 - 47624258
Alignment:
| Q |
174 |
ttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47624208 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
47624258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 118 - 225
Target Start/End: Complemental strand, 44403660 - 44403552
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatac-accaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttg |
216 |
Q |
| |
|
||||||||||||| | | |||||| ||| | | ||||| || ||||||||||||||||||||||||||| | ||||| | ||||||||||||||||| || |
|
|
| T |
44403660 |
ctcttgtgtaaaagacaaggtaaggctgcggagaataccacaaaatggtgggaccccttcccggaccctacgtatgctgaagctttagtgcaccgggctg |
44403561 |
T |
 |
| Q |
217 |
cccttttta |
225 |
Q |
| |
|
|| |||||| |
|
|
| T |
44403560 |
cctttttta |
44403552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 108 - 221
Target Start/End: Complemental strand, 45139592 - 45139479
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacc--aaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||||| ||||||||||||| | |||||||| ||| ||||||||||| |||||||||||||||||||| || ||||| ||||||||| |||| || |
|
|
| T |
45139592 |
tggaaacaacctcttgtgtaaaacacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccaga-cctgcgtatgcgggaacttt-gt |
45139495 |
T |
 |
| Q |
206 |
gcaccgggttgccctt |
221 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
45139494 |
gcaccgggctgccctt |
45139479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 106 - 222
Target Start/End: Original strand, 31831240 - 31831343
Alignment:
| Q |
106 |
tctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||| ||| |||||||||||||||||| |||||||||||||||||||| ||| |||| |
|
|
| T |
31831240 |
tctggaaacagcctcttgtgtaaaa--tagggtaaggctgcatacaatacaccaaatggt-----------ccggaccctgcatatgcgggtgctctagt |
31831326 |
T |
 |
| Q |
206 |
gcaccgggttgcccttt |
222 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
31831327 |
gcaccgggttgcccttt |
31831343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 157 - 224
Target Start/End: Original strand, 35417996 - 35418063
Alignment:
| Q |
157 |
ccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||| ||||||||||||| |||| ||||| |||| |
|
|
| T |
35417996 |
ccaaatggtgggaccccttcccggaccccgcaaatgcgagagctttagtgcatcgggctgcccatttt |
35418063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 54032674 - 54032570
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| ||| ||||||||||| ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
54032674 |
ctggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccgaatggtgggaccc------------tgcgtatgcgggagctttagtg |
54032587 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
54032586 |
caccgggttgccctttt |
54032570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 151 - 208
Target Start/End: Complemental strand, 46170038 - 46169981
Alignment:
| Q |
151 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgca |
208 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
46170038 |
aataaaccaaatggtaggaccccttcccggaccctgcatatgtgggagcttcagtgca |
46169981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 176 - 224
Target Start/End: Complemental strand, 6242331 - 6242283
Alignment:
| Q |
176 |
cccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
6242331 |
cccggaccctgcatatgcaggagctctagtgcaccgggttgcccttttt |
6242283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 107 - 208
Target Start/End: Complemental strand, 43114985 - 43114882
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaat-agggtaaga-ctgtgtacaatacaccaaatggtgggaccccttcccgga-ccctgcatatgcgggagcttta |
203 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| || |||||||||||||||||||||| ||||||| ||| |||||| ||||||||||||||| |
|
|
| T |
43114985 |
ctggaaacagcctcttgtgtaaaaaaacagggtaagggctacctacaatacaccaaatggtggga-cccttcctggacccctgcgtatgcgggagcttta |
43114887 |
T |
 |
| Q |
204 |
gtgca |
208 |
Q |
| |
|
||||| |
|
|
| T |
43114886 |
gtgca |
43114882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 106 - 213
Target Start/End: Complemental strand, 52428593 - 52428479
Alignment:
| Q |
106 |
tctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgg-------gaccccttcccggaccctgcatatgcgggag |
198 |
Q |
| |
|
||||||| ||| ||||||||||||| | |||||||| ||| |||||||||||||||| |||| |||||||| |||||||| | |||| ||||| |
|
|
| T |
52428593 |
tctggaagcagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatagtggaaccccaaaccccttctcggaccctacgtatgtgggag |
52428494 |
T |
 |
| Q |
199 |
ctttagtgcaccggg |
213 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52428493 |
ctttagtgcaccggg |
52428479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 108 - 212
Target Start/End: Original strand, 52952529 - 52952633
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
|||||||| ||||| ||||||||||| | ||||||||||||||||||||||||| |||||||| ||| | || || |||| || |||||||||||| |
|
|
| T |
52952529 |
tggaaacaacctcttatgtaaaaaatatgataagactgtgtacaatacaccaaatagtgggacctcttttcaaactctttatatacgagagctttagtgc |
52952628 |
T |
 |
| Q |
208 |
accgg |
212 |
Q |
| |
|
||||| |
|
|
| T |
52952629 |
accgg |
52952633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 181 - 224
Target Start/End: Original strand, 40390357 - 40390400
Alignment:
| Q |
181 |
accctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40390357 |
accctgcgtatgcgggagctttagtgcaccgggttgcccttttt |
40390400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 162 - 222
Target Start/End: Complemental strand, 14266431 - 14266372
Alignment:
| Q |
162 |
tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
||||||||||| |||| | ||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
14266431 |
tggtgggaccc-ttcctgaaccctgcgtatgcgggagctttagtgcactgggttgcccttt |
14266372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 159 - 223
Target Start/End: Original strand, 40968612 - 40968676
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||||||| |||||||||| |||||| |||||||||||||||||||||| || | ||||||||| |
|
|
| T |
40968612 |
aaatggtgagaccccttcctagaccctacatatgcgggagctttagtgcatcgagctgccctttt |
40968676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 106 - 169
Target Start/End: Complemental strand, 45620945 - 45620881
Alignment:
| Q |
106 |
tctggaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaaatggtggga |
169 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||| ||| |||||||||||||| |||||||| |
|
|
| T |
45620945 |
tctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaattggtggga |
45620881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 202
Target Start/End: Complemental strand, 8410966 - 8410887
Alignment:
| Q |
123 |
gtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt |
202 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||| |||||||||| |||| | ||||||||||| |||| |||||| |
|
|
| T |
8410966 |
gtgtaaaaaacagggtaaggctgctcacaatacaccaactggtgggacctcttctcagaccctgcataggcggaagcttt |
8410887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 107 - 218
Target Start/End: Original strand, 19751620 - 19751731
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||| || |||||||||||||| | |||||| || |||||||||||| | ||||||||||| ||||| ||| || ||||| ||||||||||| |
|
|
| T |
19751620 |
ctggaaatagcctcttgtgtaaaaatcaaggtaaggttgcgtacaatacacctattggtgggaccctttcccagactttgtgtatgcatgagctttagtg |
19751719 |
T |
 |
| Q |
207 |
caccgggttgcc |
218 |
Q |
| |
|
||||||| |||| |
|
|
| T |
19751720 |
caccgggctgcc |
19751731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 111 - 165
Target Start/End: Complemental strand, 21796885 - 21796832
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggt |
165 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||| ||| |||||||| |
|
|
| T |
21796885 |
aaacagtctcttgtgtaaaaa-tagggtaagactctgtacaaaacatcaaatggt |
21796832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 116 - 177
Target Start/End: Original strand, 38425235 - 38425297
Alignment:
| Q |
116 |
gtctcttgtgtaaaaaatagggtaagactgtgtacaatacacc-aaatggtgggaccccttcc |
177 |
Q |
| |
|
||||||| | |||| |||||||||| ||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
38425235 |
gtctcttatataaagaatagggtaaaactgtgttcaatacaccaaaatggtgggaccccttcc |
38425297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 110 - 163
Target Start/End: Original strand, 26782411 - 26782464
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatg |
163 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||| || ||||||||||||| |
|
|
| T |
26782411 |
gaaacaatctcttgtgtaaaaaatagggtaatgctgtataaaatacaccaaatg |
26782464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 43956515 - 43956470
Alignment:
| Q |
179 |
ggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43956515 |
ggacccagcgtatgcgggagctttagtgcaccgggctgcccttttt |
43956470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 107 - 210
Target Start/End: Original strand, 31672735 - 31672839
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggac-cccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||||||| || || ||||||||| | || |||| || |||||||||||||||||||||||| | |||||| | | | | | ||||||||||||||| |
|
|
| T |
31672735 |
ctggaaacagcctattatgtaaaaaacaaggcaagagtgcgtacaatacaccaaatggtgggactctcttcccatatcttacgtgtgcgggagctttagt |
31672834 |
T |
 |
| Q |
206 |
gcacc |
210 |
Q |
| |
|
||||| |
|
|
| T |
31672835 |
gcacc |
31672839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 168 - 224
Target Start/End: Original strand, 51644074 - 51644130
Alignment:
| Q |
168 |
gaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||| |||||||| |||||| |||||||||||||||| | |||||||||| |
|
|
| T |
51644074 |
gaccccttcctggaccctgggtatgcgagagctttagtgcaccgcggtgcccttttt |
51644130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 23871484 - 23871523
Alignment:
| Q |
183 |
cctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
23871484 |
cctgcgtatgcgggaactttagtgcaccgggttgcccttt |
23871523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 166 - 221
Target Start/End: Complemental strand, 45288111 - 45288056
Alignment:
| Q |
166 |
gggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt |
221 |
Q |
| |
|
|||||| ||||||||||||||| ||||| ||||||||||||||| || ||||||| |
|
|
| T |
45288111 |
gggacctcttcccggaccctgcgtatgcaagagctttagtgcaccaggctgccctt |
45288056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 223
Target Start/End: Complemental strand, 45416986 - 45416933
Alignment:
| Q |
169 |
accccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||||| ||||| | |||||| |||||||||| ||||||||| |
|
|
| T |
45416986 |
accccttcccggaccctgcgtatgcagaagcttt-gtgcaccgggctgccctttt |
45416933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 224
Target Start/End: Complemental strand, 10696272 - 10696211
Alignment:
| Q |
163 |
ggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||| |||||||| | | ||||||| ||||||||| || |||||||||| |
|
|
| T |
10696272 |
ggtgggaccccttcccagaccctgcgtctacgggagcattagtgcactaggctgcccttttt |
10696211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 118 - 175
Target Start/End: Original strand, 29106602 - 29106659
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggacccctt |
175 |
Q |
| |
|
||||||||||||||||||| |||| | |||||||||||||||| |||||| ||||| |
|
|
| T |
29106602 |
ctcttgtgtaaaaaataggataaggttacgtacaatacaccaaattgtgggatccctt |
29106659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 158 - 222
Target Start/End: Original strand, 4835835 - 4835899
Alignment:
| Q |
158 |
caaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||| ||| ||| ||| ||||||||||| ||| || |||||| |||||||||||||| ||||| |
|
|
| T |
4835835 |
caaatgatggaaccgctttccggaccctgcgtatacgtgagcttcagtgcaccgggttgtccttt |
4835899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 127 - 195
Target Start/End: Complemental strand, 21330341 - 21330273
Alignment:
| Q |
127 |
aaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgg |
195 |
Q |
| |
|
||||||||||||||| | | ||||||||||||||| | ||||||| |||| |||| ||||||||||| |
|
|
| T |
21330341 |
aaaaaatagggtaaggccgcatacaatacaccaaattgcgggaccctttcctagaccatgcatatgcgg |
21330273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 89; Significance: 7e-43; HSPs: 73)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 8455431 - 8455315
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | |||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
8455431 |
ctggaaacagcctcttgtgtaaaacacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgccggagctttagtg |
8455332 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
8455331 |
caccgggttgccctttt |
8455315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 107 - 223
Target Start/End: Original strand, 9671201 - 9671315
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9671201 |
ctggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg |
9671298 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9671299 |
caccgggttgccctttt |
9671315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 14444749 - 14444865
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14444749 |
ctggaaacagcctcttgtgtaaaaac-agggtaaggctgtgtacgatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg |
14444847 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
14444848 |
caccaggttgcccttttt |
14444865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 107 - 222
Target Start/End: Original strand, 10543718 - 10543835
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||| | ||||||||||||||| |||||||| ||| ||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10543718 |
ctggaaacggcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttag |
10543817 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
10543818 |
tgcaccgggttgcccttt |
10543835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 10546182 - 10546300
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||| ||||||| ||||||| |||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10546182 |
ctggaaacatcctcttgtataaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagt |
10546281 |
T |
 |
| Q |
206 |
gcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
10546282 |
gcaccgggttgcccttttt |
10546300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 107 - 222
Target Start/End: Original strand, 14530338 - 14530455
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||| ||||||| |||||||| || |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14530338 |
ctggaaacagcctcttgtataaaaaacagggtaaggctacgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttag |
14530437 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
14530438 |
tgcaccgggttgcccttt |
14530455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 21779374 - 21779260
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||| |||| ||||||||||||| | ||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21779374 |
ctggagacagcctcttgtgtaaaaca--gggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
21779277 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
21779276 |
caccgggttgccctttt |
21779260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 36871513 - 36871628
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||| |||| |||||||| ||| ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
36871513 |
ctggaaacagcctcttgtgtgaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgga-cctgcgtatgcgggagctttagtg |
36871610 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36871611 |
caccgggttgcccttttt |
36871628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 107 - 222
Target Start/End: Original strand, 23397786 - 23397899
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||| || |||||||||||||||||||||||||||||| |||||||| |||||||||||||| ||||| |
|
|
| T |
23397786 |
ctggaaacagcctcttgtgtaaaa--tagggtaaggctacgtacaatacaccaaatggtgggaccccttctcggaccctacatatgcgggagctctagtg |
23397883 |
T |
 |
| Q |
207 |
caccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
23397884 |
caccgggttgcccttt |
23397899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 108 - 224
Target Start/End: Complemental strand, 25249851 - 25249736
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| ||| ||||||||||||||||||||||| ||||||||| ||||||| |||||| |||||||||||| |
|
|
| T |
25249851 |
tggaaacagtctcttgtgtacaaac-agggtaaggctgcgtacaatacaccaaatggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgc |
25249753 |
T |
 |
| Q |
208 |
accgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
25249752 |
accgggttgcccttttt |
25249736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 107 - 222
Target Start/End: Complemental strand, 40762349 - 40762234
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||| || |||||||||||||||||||||||||| |||| ||||||||| |||| ||||||||||||| |
|
|
| T |
40762349 |
ctggaaacagcctcttgtgtaaaaaactgggtaaggctacgtacaatacaccaaatggtgggaccctttcctggaccctgcgtatgtgggagctttagtg |
40762250 |
T |
 |
| Q |
207 |
caccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40762249 |
caccgggttgcccttt |
40762234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 110 - 223
Target Start/End: Original strand, 5841051 - 5841166
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||| || ||||||||||||||||||||| || |||||||||| ||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5841051 |
gaaacagccttttgtgtaaaaaatagggtaaggatgcgtacaatacatcaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgc |
5841150 |
T |
 |
| Q |
208 |
accgggttgccctttt |
223 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
5841151 |
accgagttgccctttt |
5841166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 107 - 223
Target Start/End: Original strand, 11514456 - 11514571
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||||| | ||||| ||| ||||||||||||||||||||||| |||||||| |||||||| |||||||||||||||||| |
|
|
| T |
11514456 |
ctggaaacagcctcttgtgtaaaaaacaaagtaaggctgcgtacaatacaccaaatggtggga-cccttcccagaccctgcgtatgcgggagctttagtg |
11514554 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
|||||| |||||||||| |
|
|
| T |
11514555 |
caccggattgccctttt |
11514571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 24200740 - 24200622
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| ||| ||||||||||||||| |||||||| |||||||||||||||| |||| | ||||||||| |
|
|
| T |
24200740 |
ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaacccttcccggaccctgagtatgtgagagctttag |
24200641 |
T |
 |
| Q |
205 |
tgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
24200640 |
tgcaccgggttgccctttt |
24200622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 118 - 225
Target Start/End: Original strand, 17896290 - 17896398
Alignment:
| Q |
118 |
ctcttgtgtaaaa-aatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttg |
216 |
Q |
| |
|
||||||||||||| ||||||||||| ||| |||||||| ||||||||||||||||||||| |||||||||| |||| ||||||||||||||| || |||| |
|
|
| T |
17896290 |
ctcttgtgtaaaaaaatagggtaaggctgcgtacaatataccaaatggtgggaccccttctcggaccctgcgtatgtgggagctttagtgcatcgagttg |
17896389 |
T |
 |
| Q |
217 |
cccttttta |
225 |
Q |
| |
|
||||||||| |
|
|
| T |
17896390 |
cccttttta |
17896398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 118 - 224
Target Start/End: Original strand, 17668033 - 17668139
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgc |
217 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||||||||||||||||||| |||||||| || ||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
17668033 |
ctcttgtgtaaaaatcagggtaaggctgcgtacaatacaccaaatggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccgggttgc |
17668132 |
T |
 |
| Q |
218 |
ccttttt |
224 |
Q |
| |
|
||||||| |
|
|
| T |
17668133 |
ccttttt |
17668139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 109 - 202
Target Start/End: Complemental strand, 32781401 - 32781308
Alignment:
| Q |
109 |
ggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt |
202 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
32781401 |
ggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcccagaccctgtgtatgcgggagcttt |
32781308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 39914421 - 39914305
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| ||||||||||||||| |||||||||||||||||| | ||||||| ||||||||||||||||| |
|
|
| T |
39914421 |
ctggaaacaacctcttgtgtaaaaaaacagggtaaggatgtgtacaatacaccgaatggtgggaccccttcctg-accctgcgtatgcgggagctttagt |
39914323 |
T |
 |
| Q |
206 |
gcaccgggttgccctttt |
223 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
39914322 |
gcatcgggttgccctttt |
39914305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 118 - 225
Target Start/End: Complemental strand, 21377177 - 21377071
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgc |
217 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||| ||||||||||||||||||||||||| ||||||| |||| ||||||||| |||||||| | ||| |
|
|
| T |
21377177 |
ctcttgtgtaaaaaacagggtaaggctgggtacaatgcaccaaatggtgggaccccttcccgaaccctgcgtatgtgggagcttt-gtgcaccgagctgc |
21377079 |
T |
 |
| Q |
218 |
ccttttta |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
21377078 |
ccttttta |
21377071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 118 - 224
Target Start/End: Original strand, 17623595 - 17623701
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgc |
217 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||||||||||||||||||| ||||||||||| | ||||| |||| || ||||||||||||| ||||||| |
|
|
| T |
17623595 |
ctcttgtgtaaaaatcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcactgggttgc |
17623694 |
T |
 |
| Q |
218 |
ccttttt |
224 |
Q |
| |
|
||||||| |
|
|
| T |
17623695 |
ccttttt |
17623701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 106 - 224
Target Start/End: Complemental strand, 19977830 - 19977712
Alignment:
| Q |
106 |
tctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||||| ||||| ||||||||||||| |||| || ||||||||||||||||||||||| ||||||||| ||| || ||||||||||||||||| |
|
|
| T |
19977830 |
tctggaaacagcctcttttgtaaaaaataggataaggttgcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttagt |
19977731 |
T |
 |
| Q |
206 |
gcaccgggttgcccttttt |
224 |
Q |
| |
|
||||| | || |||||||| |
|
|
| T |
19977730 |
gcaccagattacccttttt |
19977712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 108 - 222
Target Start/End: Complemental strand, 40416985 - 40416871
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
|||||||| ||||||| ||||||| |||| ||| |||||||||||||||||| || |||||||| || |||||||||||||||| |||||||||||| |
|
|
| T |
40416985 |
tggaaacaacctcttgtataaaaaacagggaaaggctgtgtacaatacaccaattgatgggacccttttttggaccctgcatatgcgagagctttagtgc |
40416886 |
T |
 |
| Q |
208 |
accgggttgcccttt |
222 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
40416885 |
accgggttgcccttt |
40416871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 110 - 219
Target Start/End: Complemental strand, 4516463 - 4516354
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
209 |
Q |
| |
|
||||||| ||||||||||||||| |||| || ||| |||||||||||||| |||||||||||||||||||||||||| |||| || |||||||||| || |
|
|
| T |
4516463 |
gaaacagcctcttgtgtaaaaaacagggcaacgctgcgtacaatacaccaattggtgggaccccttcccggaccctgcgtatgtggaagctttagtgtac |
4516364 |
T |
 |
| Q |
210 |
cgggttgccc |
219 |
Q |
| |
|
|||| ||||| |
|
|
| T |
4516363 |
cgggctgccc |
4516354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 118 - 222
Target Start/End: Complemental strand, 25079822 - 25079717
Alignment:
| Q |
118 |
ctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttg |
216 |
Q |
| |
|
||||||||||||||| | |||||| || |||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
25079822 |
ctcttgtgtaaaaaaacaaggtaaggatgcgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttg |
25079723 |
T |
 |
| Q |
217 |
cccttt |
222 |
Q |
| |
|
|||||| |
|
|
| T |
25079722 |
cccttt |
25079717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 122 - 222
Target Start/End: Original strand, 25632544 - 25632644
Alignment:
| Q |
122 |
tgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt |
221 |
Q |
| |
|
||||||||||| ||| |||| ||| ||||||||||||||||||||||| |||||||| ||| | | ||||||||||||||||||||||||||||||||| |
|
|
| T |
25632544 |
tgtgtaaaaaacaggataaggctgcgtacaatacaccaaatggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgccctt |
25632643 |
T |
 |
| Q |
222 |
t |
222 |
Q |
| |
|
| |
|
|
| T |
25632644 |
t |
25632644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 108 - 224
Target Start/End: Original strand, 30826058 - 30826172
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||| || ||||||||||||||||||||| |||| ||||| |||||| ||||||||||||||||||||| |
|
|
| T |
30826058 |
tggaaacagcctcttgtgtaaaaa-tagggtaaggttgcgtacaatacaccaaatggtggaaccc-ttcccagaccctacatatgcgggagctttagtgc |
30826155 |
T |
 |
| Q |
208 |
accgggttgcccttttt |
224 |
Q |
| |
|
||| | ||| ||||||| |
|
|
| T |
30826156 |
accagattgtccttttt |
30826172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 107 - 212
Target Start/End: Complemental strand, 12024033 - 12023929
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| ||| ||||||||||||||||||||||||||| ||||||||||||| ||| || ||||||| || |
|
|
| T |
12024033 |
ctggaaacagcctcttgtgtaaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccctcccggaccctgcgtatttggaagctttaatg |
12023935 |
T |
 |
| Q |
207 |
caccgg |
212 |
Q |
| |
|
|||||| |
|
|
| T |
12023934 |
caccgg |
12023929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 162 - 223
Target Start/End: Original strand, 34080176 - 34080237
Alignment:
| Q |
162 |
tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34080176 |
tggtgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgccctttt |
34080237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 118 - 225
Target Start/End: Complemental strand, 26684725 - 26684617
Alignment:
| Q |
118 |
ctcttgtgtaaaaaa-tagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttg |
216 |
Q |
| |
|
||||||||||||||| || |||||| ||| |||||||| || ||||||||||||| ||||||| ||||||| ||||||||||||||| |||||||| ||| |
|
|
| T |
26684725 |
ctcttgtgtaaaaaaatatggtaaggctgcgtacaatatactaaatggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccggattg |
26684626 |
T |
 |
| Q |
217 |
cccttttta |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
26684625 |
tccttttta |
26684617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 127 - 223
Target Start/End: Original strand, 44643563 - 44643659
Alignment:
| Q |
127 |
aaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||||| || ||||| ||| ||||||| ||||||||||||||||||||||| |||||||| ||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
44643563 |
aaaaaacagagtaaggctgcgtacaatgtaccaaatggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgccctttt |
44643659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 107 - 222
Target Start/End: Original strand, 14544083 - 14544201
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgta-aaaaatagggtaagactgtgtacaata--caccaaatggtgggaccccttcccggaccctgcatatgcgggagcttta |
203 |
Q |
| |
|
|||||||||| |||||||||| ||||| |||||||||||| || ||||| || ||||||| ||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
14544083 |
ctggaaacagcctcttgtgtagaaaaacagggtaagactgcgtgcaataaccaaaaaatggtcggaccccttccgggaccctgcgtatgcgggagcttta |
14544182 |
T |
 |
| Q |
204 |
gtgcaccgggttgcccttt |
222 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
14544183 |
gtgcaccaagttgcccttt |
14544201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 161 - 220
Target Start/End: Original strand, 41409936 - 41409995
Alignment:
| Q |
161 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccct |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41409936 |
atggtgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgccct |
41409995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 136 - 221
Target Start/End: Complemental strand, 13245181 - 13245096
Alignment:
| Q |
136 |
ggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt |
221 |
Q |
| |
|
|||||| ||| ||||| ||||| ||||||||||||||||||||||||| ||||||| |||||||||||||| | |||||||||||| |
|
|
| T |
13245181 |
ggtaaggctgcgtacattacactaaatggtgggaccccttcccggaccatgcatatacgggagctttagtgtatcgggttgccctt |
13245096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 147 - 224
Target Start/End: Complemental strand, 24860063 - 24859986
Alignment:
| Q |
147 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||||||||| | |||||||| |||||||||| |||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
24860063 |
gtacaatacaccaaatggtagaaccccttctcggaccctgcgtatgcgggagctttagtgcaccggattgcctttttt |
24859986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 111 - 225
Target Start/End: Complemental strand, 31158552 - 31158436
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttagtgca |
208 |
Q |
| |
|
|||||| |||||| |||||||| ||||||||| || ||||||| |||||| ||||||||||||||||| |||||||| ||||||||||||||||| || |
|
|
| T |
31158552 |
aaacagcctcttgcgtaaaaaacagggtaagattgcatacaataaaccaaaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtaca |
31158453 |
T |
 |
| Q |
209 |
ccgggttgcccttttta |
225 |
Q |
| |
|
|| | ||| |||||||| |
|
|
| T |
31158452 |
cctgattgtccttttta |
31158436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 159 - 223
Target Start/End: Original strand, 23488555 - 23488619
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| ||||| |
|
|
| T |
23488555 |
aaatggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgctctttt |
23488619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 122 - 210
Target Start/End: Complemental strand, 31821443 - 31821355
Alignment:
| Q |
122 |
tgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| ||||||||||| ||| | |||| ||||||||||||||| |||||| |
|
|
| T |
31821443 |
tgtgtaaaaaatagggtaaggttgtgtacaatacaccaaatgatgggacccctttccgaaacctgtgtatgcgggagctttaatgcacc |
31821355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 161 - 221
Target Start/End: Complemental strand, 40579810 - 40579750
Alignment:
| Q |
161 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt |
221 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40579810 |
atggtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccctt |
40579750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 108 - 224
Target Start/End: Original strand, 7214555 - 7214673
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacac--caaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||||||||||||||||| | |||||||| ||| ||||||||||| |||||||| || |||||| ||||| |||| |||||| ||| |||||| |
|
|
| T |
7214555 |
tggaaacagtctcttgtgtaaaatacagggtaaggctgcgtacaatacacaaaaaatggtgagatcccttctcggacactgcgtatgcgagagttttagt |
7214654 |
T |
 |
| Q |
206 |
gcaccgggttgcccttttt |
224 |
Q |
| |
|
||||| ||||||| ||||| |
|
|
| T |
7214655 |
gcaccaggttgcctttttt |
7214673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 127 - 209
Target Start/End: Original strand, 24890451 - 24890533
Alignment:
| Q |
127 |
aaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
209 |
Q |
| |
|
|||||| | |||||| ||| ||||||||||||| |||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
24890451 |
aaaaaacaaggtaaggctgcatacaatacaccaattggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac |
24890533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 162 - 224
Target Start/End: Original strand, 34766330 - 34766392
Alignment:
| Q |
162 |
tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||| |
|
|
| T |
34766330 |
tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggtttcccttttt |
34766392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 110 - 212
Target Start/End: Original strand, 17471571 - 17471675
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||| ||||||||||||||| ||| |||||||| |||||||| |||||| || || ||||||||||| |||||||| |||||||||| |||||||| |
|
|
| T |
17471571 |
gaaacagcctcttgtgtaaaaaaacaggataagactgcgtacaatataccaaaatgatgagaccccttccctgaccctgcctatgcgggagttttagtgc |
17471670 |
T |
 |
| Q |
208 |
accgg |
212 |
Q |
| |
|
||||| |
|
|
| T |
17471671 |
accgg |
17471675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 168 - 222
Target Start/End: Complemental strand, 3633762 - 3633708
Alignment:
| Q |
168 |
gaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3633762 |
gaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttt |
3633708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 128 - 186
Target Start/End: Original strand, 22371095 - 22371153
Alignment:
| Q |
128 |
aaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctg |
186 |
Q |
| |
|
||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22371095 |
aaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
22371153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 174 - 223
Target Start/End: Original strand, 22371199 - 22371248
Alignment:
| Q |
174 |
ttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22371199 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
22371248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 111 - 184
Target Start/End: Complemental strand, 23145809 - 23145736
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccc |
184 |
Q |
| |
|
|||||| ||||||||||||||| || ||||| ||| |||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
23145809 |
aaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaattggtgggaccctttcccggaccc |
23145736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 111 - 184
Target Start/End: Complemental strand, 23557599 - 23557526
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccc |
184 |
Q |
| |
|
|||||| ||||||||||||||| || ||||| ||| |||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
23557599 |
aaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaattggtgggaccctttcccggaccc |
23557526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 147 - 224
Target Start/End: Original strand, 25641561 - 25641638
Alignment:
| Q |
147 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| | ||||| |||||| ||||||||||| ||||| ||| ||||||| |
|
|
| T |
25641561 |
gtacaatacaccaaattgtgggaccccttcccgaatcctgcgtatgcgagagctttagtgaaccggattgtccttttt |
25641638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 136 - 225
Target Start/End: Original strand, 27573669 - 27573758
Alignment:
| Q |
136 |
ggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttta |
225 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||| ||| ||||| |||||| |||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
27573669 |
ggtaaggctgcgtacaatacaccaaatggtggaaccatttcccaaaccctgtgtatgtgggagctttagtgcatcgggttgcccttttta |
27573758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 160 - 223
Target Start/End: Original strand, 1289095 - 1289159
Alignment:
| Q |
160 |
aatggtgggaccccttcccggaccctgcatatgcgggagc-tttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
1289095 |
aatggtgggaccccttcccggatcatgcatatgcgggagcttttagtgcaccggattgccctttt |
1289159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 167 - 222
Target Start/End: Original strand, 8575975 - 8576030
Alignment:
| Q |
167 |
ggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||| |
|
|
| T |
8575975 |
ggaccccttcccggaccctgcgtatgtgggagctttagtgcaccaggttgcccttt |
8576030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 118 - 210
Target Start/End: Original strand, 19615023 - 19615116
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
||||||| ||||||| |||||||||||| |||||||| ||||| || |||| ||||||||||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
19615023 |
ctcttgtataaaaaacagggtaagactgcgtacaatataccaataatagtgg-accccttcccgaaccctgcgtatgcaggagctttagtgcacc |
19615116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 152 - 219
Target Start/End: Original strand, 31525771 - 31525838
Alignment:
| Q |
152 |
atacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccc |
219 |
Q |
| |
|
|||||||||||| |||||||| || || ||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
31525771 |
atacaccaaatgatgggaccctttgccagaccctgcatatgcgggagctttagtgtaccggattgccc |
31525838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 108 - 203
Target Start/End: Complemental strand, 44521487 - 44521392
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttta |
203 |
Q |
| |
|
|||||||| |||||||||||||||| | |||||| ||| || |||||||||||||| |||| |||||||| ||| ||||||| ||||||||||| |
|
|
| T |
44521487 |
tggaaacaatctcttgtgtaaaaaacaaggtaaggctgcatataatacaccaaatggcgggagcccttcccagacattgcatatacgggagcttta |
44521392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 110 - 224
Target Start/End: Complemental strand, 45235930 - 45235815
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaa-aatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgca |
208 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| || || ||||||| ||||||||||||||||| || |||||| | ||||| |||||||||||| | |
|
|
| T |
45235930 |
gaaacagtctcttctgtaaaataatagggtaaggctacgtgtaatacacaaaatggtgggaccccttaccagaccctacgtatgcaggagctttagtgta |
45235831 |
T |
 |
| Q |
209 |
ccgggttgcccttttt |
224 |
Q |
| |
|
|| ||||||| |||| |
|
|
| T |
45235830 |
ccaagttgcccctttt |
45235815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 124 - 206
Target Start/End: Complemental strand, 99363 - 99281
Alignment:
| Q |
124 |
tgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| | || ||| ||| ||||||||||||||||||||| |||||||| | ||||||| |||||||||||||||||| |
|
|
| T |
99363 |
tgtaaaaaacatggcaaggctgcgtacaatacaccaaatggtggaaccccttctcagaccctgtgtatgcgggagctttagtg |
99281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 108 - 222
Target Start/End: Complemental strand, 17380350 - 17380238
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
|||||||| |||||||||| ||| |||||||| ||||| |||||||||||||| ||| ||||||||| ||||||||| ||||||||||||| |||| |
|
|
| T |
17380350 |
tggaaacaacctcttgtgtataaac-agggtaaggttgtgtgcaatacaccaaatgatggaaccccttcctggaccctgcggatgcgggagcttt-gtgc |
17380253 |
T |
 |
| Q |
208 |
accgggttgcccttt |
222 |
Q |
| |
|
|||||| | |||||| |
|
|
| T |
17380252 |
accgggcttcccttt |
17380238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 152 - 214
Target Start/End: Original strand, 31523296 - 31523358
Alignment:
| Q |
152 |
atacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggt |
214 |
Q |
| |
|
|||||||||||||||| |||| ||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
31523296 |
atacaccaaatggtggaaccctttcccaaaccctgcatatgcgggagctttagtgcactgggt |
31523358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 39499324 - 39499242
Alignment:
| Q |
128 |
aaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
||||||||||||| ||| |||||||||| |||||||||||| ||||| || | ||||| |||||||||||||||||||||| |
|
|
| T |
39499324 |
aaaaatagggtaaagctgcgtacaatacatcaaatggtgggatcccttttcgaatcctgcgtatgcgggagctttagtgcacc |
39499242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 156 - 209
Target Start/End: Original strand, 4794871 - 4794924
Alignment:
| Q |
156 |
accaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
209 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
4794871 |
accaaatgatgggaccccttcccggatcctgcatatgcgggagctctagtgcac |
4794924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 171 - 224
Target Start/End: Complemental strand, 39189555 - 39189502
Alignment:
| Q |
171 |
cccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
39189555 |
cccttcccggaccccgcatatgcgggagctctagtgcaccgggttgcctttttt |
39189502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 174 - 218
Target Start/End: Complemental strand, 124962 - 124918
Alignment:
| Q |
174 |
ttcccggaccctgcatatgcgggagctttagtgcaccgggttgcc |
218 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
124962 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
124918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 107 - 185
Target Start/End: Original strand, 5450305 - 5450384
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccct |
185 |
Q |
| |
|
||||||||| ||||||||||||||| | |||||| ||| ||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
5450305 |
ctggaaacaacctcttgtgtaaaaaaacatggtaaggctgcgtacaatacaccaaagggtgggaccccttcctggaccct |
5450384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 151 - 206
Target Start/End: Complemental strand, 24059067 - 24059012
Alignment:
| Q |
151 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||| |||| ||||||||||||| |
|
|
| T |
24059067 |
aatacaccatatggtgggacccctttccggaccctgcgtatgtgggagctttagtg |
24059012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 109 - 202
Target Start/End: Original strand, 33795307 - 33795400
Alignment:
| Q |
109 |
ggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaa-tacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt |
202 |
Q |
| |
|
||||||| |||||| |||||||| |||||||| ||| |||||| |||||| | ||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
33795307 |
ggaaacaacctcttgggtaaaaaacagggtaaggctgcgtacaaatacaccta-tggtgggaccccttcccagaccctgtgtatgcgggagcttt |
33795400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 108 - 212
Target Start/End: Complemental strand, 30864530 - 30864427
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||| || |||||||| |||||||||| || || ||||| ||||||| ||||||| ||||| |||| |
|
|
| T |
30864530 |
tggaaacagcctcttgtgtaaaaa-tagggtaagggtgcgtacaatataccaaatggtaagatcctttcccaaaccctgcgtatgcggaagcttcggtgc |
30864432 |
T |
 |
| Q |
208 |
accgg |
212 |
Q |
| |
|
||||| |
|
|
| T |
30864431 |
accgg |
30864427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 126 - 177
Target Start/End: Complemental strand, 12315748 - 12315697
Alignment:
| Q |
126 |
taaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcc |
177 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||| ||| |||||| |
|
|
| T |
12315748 |
taaaaaacagggtaagactgtgtacaatacaccaaatagtgagactccttcc |
12315697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 159 - 222
Target Start/End: Complemental strand, 19185806 - 19185743
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
||||||||| ||||||||| ||||||||| ||||||||||||||||| || || ||| |||||| |
|
|
| T |
19185806 |
aaatggtggaaccccttcctggaccctgcgtatgcgggagctttagtacatcgagttacccttt |
19185743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 128 - 210
Target Start/End: Complemental strand, 44449478 - 44449395
Alignment:
| Q |
128 |
aaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcacc |
210 |
Q |
| |
|
||||| ||| |||| ||| ||||||||||||||| | |||||||||||||||||||||||| | || ||||| |||| |||||| |
|
|
| T |
44449478 |
aaaaacaggataaggctgcgtacaatacaccaaaatagtgggaccccttcccggaccctgcgtttgtgggagttttaatgcacc |
44449395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 223
Target Start/End: Original strand, 4795807 - 4795891
Alignment:
| Q |
140 |
agactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||||| || |||||||||||| |||||||||| |||||||||| || ||||| | |||||||||||| ||||||||||||| |
|
|
| T |
4795807 |
agactgcgtgcaatacaccaaaatggtgggaccttttcccggaccttgtgtatgccgaagctttagtgcagtgggttgccctttt |
4795891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 175 - 225
Target Start/End: Complemental strand, 23053012 - 23052962
Alignment:
| Q |
175 |
tcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttta |
225 |
Q |
| |
|
|||| |||||||| ||||| |||||||| |||||||||| ||||||||||| |
|
|
| T |
23053012 |
tcccagaccctgcgtatgcaggagcttttgtgcaccgggctgcccttttta |
23052962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 153 - 181
Target Start/End: Original strand, 4252656 - 4252684
Alignment:
| Q |
153 |
tacaccaaatggtgggaccccttcccgga |
181 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4252656 |
tacaccaaatggtgggaccccttcccgga |
4252684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 107 - 159
Target Start/End: Original strand, 17705515 - 17705567
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacca |
159 |
Q |
| |
|
|||||||| | |||||||||||| || || ||||| ||||||||||||||||| |
|
|
| T |
17705515 |
ctggaaaccgcctcttgtgtaaacaacagagtaaggctgtgtacaatacacca |
17705567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 86; Significance: 4e-41; HSPs: 56)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 1354870 - 1354756
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1354870 |
ctggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
1354773 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1354772 |
caccgggttgccctttt |
1354756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 107 - 225
Target Start/End: Complemental strand, 29355972 - 29355852
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||||||| ||| |||||||| ||| |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29355972 |
ctggaaacagcctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttag |
29355873 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttttta |
225 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29355872 |
tgcaccgggttgcccttttta |
29355852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 1346984 - 1347099
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| | ||||||||||| | ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1346984 |
ctggaaacagccacttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
1347081 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1347082 |
caccgggttgcccttttt |
1347099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 108 - 223
Target Start/End: Complemental strand, 12222031 - 12221913
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagc-tttag |
204 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| ||| |||||||||||||| ||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
12222031 |
tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagcttttag |
12221932 |
T |
 |
| Q |
205 |
tgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12221931 |
tgcaccgggttgccctttt |
12221913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 107 - 225
Target Start/End: Original strand, 26097180 - 26097296
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||| ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26097180 |
ctggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatgaagggaccccttcccggaccctgcatatgcgggagctctagtg |
26097277 |
T |
 |
| Q |
207 |
caccgggttgcccttttta |
225 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
26097278 |
caccgggttgcccttttta |
26097296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 107 - 225
Target Start/End: Original strand, 25557745 - 25557861
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||| ||| ||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25557745 |
ctggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatgaaggaaccccttcccggaccctgcatatgcgggagctctagtg |
25557842 |
T |
 |
| Q |
207 |
caccgggttgcccttttta |
225 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
25557843 |
caccgggttgcccttttta |
25557861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 107 - 215
Target Start/End: Complemental strand, 3815192 - 3815084
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| || |||||||||||||| |||| ||||| |||||||||||||||||||||||||| |||||| ||||| | ||||||| |||||||||| |
|
|
| T |
3815192 |
ctggaaacagactattgtgtaaaaaatatggtacgactgcgtacaatacaccaaatggtgggaccctttcccgaaccctacgtatgcggaagctttagtg |
3815093 |
T |
 |
| Q |
207 |
caccgggtt |
215 |
Q |
| |
|
||||||||| |
|
|
| T |
3815092 |
caccgggtt |
3815084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 2166527 - 2166408
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
||||||||| ||||||||||||| | ||| |||| || |||||||||||||| ||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
2166527 |
ctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttag |
2166428 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2166427 |
tgcaccgggttgcccttttt |
2166408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 107 - 224
Target Start/End: Complemental strand, 2178160 - 2178041
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
||||||||| ||||||||||||| | ||| |||| || |||||||||||||| ||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
2178160 |
ctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttag |
2178061 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2178060 |
tgcaccgggttgcccttttt |
2178041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 13267788 - 13267863
Alignment:
| Q |
150 |
caatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttta |
225 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13267788 |
caatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgcccttttta |
13267863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 9161143 - 9161261
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| |||||||||||||| || ||||| ||| |||||||||| ||| |||||||||||||||| |||||||||| ||||||| |||||||| |
|
|
| T |
9161143 |
ctggaaacagcctcttgtgtaaaaac-agagtaaggctgcgtacaatacatcaataatggtgggaccccttctcggaccctgcgtatgcggaagctttag |
9161241 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||| ||||||||||||| |
|
|
| T |
9161242 |
tgcaccaggttgcccttttt |
9161261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 12892082 - 12892146
Alignment:
| Q |
160 |
aatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12892082 |
aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttttt |
12892146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 147 - 223
Target Start/End: Complemental strand, 23930202 - 23930126
Alignment:
| Q |
147 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23930202 |
gtacaatacaccagatggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgccctttt |
23930126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 107 - 205
Target Start/End: Original strand, 32579446 - 32579543
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
|||||||||| |||| || |||||| || |||||| ||| ||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32579446 |
ctggaaacagcctctggtataaaaa-tacggtaagcctgcgtacaataccccaaatggtgggaccccttcccagaccctgcatatgcgggagctttagt |
32579543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 160 - 224
Target Start/End: Original strand, 6808468 - 6808532
Alignment:
| Q |
160 |
aatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6808468 |
aatggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttttt |
6808532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 108 - 224
Target Start/End: Complemental strand, 18277307 - 18277191
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| || ||||| |||||||||||||||||||||||| ||| || | ||||||||||||||| ||| |
|
|
| T |
18277307 |
tggaaacagcctcttgtgtaaaaatcagggtaaggttgagtacagaacaccaaatggtgggaccccttcctagactctacgtatgcgggagctttactgc |
18277208 |
T |
 |
| Q |
208 |
accgggttgcccttttt |
224 |
Q |
| |
|
||||||||| ||||||| |
|
|
| T |
18277207 |
accgggttgtccttttt |
18277191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 118 - 224
Target Start/End: Original strand, 1941886 - 1941992
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgc |
217 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||| |||||||||||||| ||| ||| | || |||||||||| ||| |||||||| ||||| |
|
|
| T |
1941886 |
ctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccatcctggatcttgtgtatgcgggagtttttgtgcaccgtgttgc |
1941985 |
T |
 |
| Q |
218 |
ccttttt |
224 |
Q |
| |
|
||||||| |
|
|
| T |
1941986 |
ccttttt |
1941992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 107 - 222
Target Start/End: Complemental strand, 7947487 - 7947371
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagt |
205 |
Q |
| |
|
||||||||| ||| |||||||||| |||||||| ||| ||||||||||||||| ||||||| |||||||||||||| ||| |||| |||||||||||| |
|
|
| T |
7947487 |
ctggaaacaacctcctgtgtaaaaaccagggtaaggctgcgtacaatacaccaaaatggtgggcccccttcccggaccttgcgtatgtgggagctttagt |
7947388 |
T |
 |
| Q |
206 |
gcaccgggttgcccttt |
222 |
Q |
| |
|
|||| || |||||||| |
|
|
| T |
7947387 |
gcacttggctgcccttt |
7947371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 159 - 223
Target Start/End: Original strand, 12885985 - 12886049
Alignment:
| Q |
159 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
223 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
12885985 |
aaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgccctttt |
12886049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 147 - 222
Target Start/End: Complemental strand, 383835 - 383760
Alignment:
| Q |
147 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||||||||||| ||||||||||||| | |||||||| ||||||||||||| ||| |||||||||||||||| |
|
|
| T |
383835 |
gtacaatacaccaaattgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgcccttt |
383760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 108 - 223
Target Start/End: Complemental strand, 32728270 - 32728156
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
|||||||| ||||| ||||||||| ||||||||||||||||||||| ||||||| || || ||| ||||| |||||| | ||||||||| ||||||||| |
|
|
| T |
32728270 |
tggaaacaacctcttatgtaaaaaacagggtaagactgtgtacaatataccaaatagt-ggtccctttcccagaccctacgtatgcgggaactttagtgc |
32728172 |
T |
 |
| Q |
208 |
accgggttgccctttt |
223 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
32728171 |
accatgttgccctttt |
32728156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 107 - 220
Target Start/End: Complemental strand, 15866152 - 15866041
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||| |||||||| ||||||| ||| ||| |||||||||||||||||||||||||||||||||||| | ||||||| || ||||| |
|
|
| T |
15866152 |
ctggaaacagcctcttaagtaaaaaacagggtaaagctgcgta--atacaccaaatggtgggaccccttcccggaccctgcgtttgcgggatctatagtg |
15866055 |
T |
 |
| Q |
207 |
caccgggttgccct |
220 |
Q |
| |
|
||| | |||||||| |
|
|
| T |
15866054 |
cactgagttgccct |
15866041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 118 - 224
Target Start/End: Original strand, 24097612 - 24097714
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgc |
217 |
Q |
| |
|
||||||| ||||||| |||||||| ||| ||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||| || |||||| |
|
|
| T |
24097612 |
ctcttgtataaaaaacagggtaaggctgcttacaa----ccaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgtcccaggttgc |
24097707 |
T |
 |
| Q |
218 |
ccttttt |
224 |
Q |
| |
|
||||||| |
|
|
| T |
24097708 |
ccttttt |
24097714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 107 - 211
Target Start/End: Original strand, 33138853 - 33138957
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||||| ||||||| ||||||| || ||||| | | |||||||||||||||||||||||||| || |||||||||| ||||| | |||||||||| |
|
|
| T |
33138853 |
ctggaaacaacctcttgtataaaaaacagagtaaggccgcgtacaatacaccaaatggtgggacccttttccggaccctgtgtatgcagtagctttagtg |
33138952 |
T |
 |
| Q |
207 |
caccg |
211 |
Q |
| |
|
||||| |
|
|
| T |
33138953 |
caccg |
33138957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 150 - 218
Target Start/End: Complemental strand, 14975164 - 14975094
Alignment:
| Q |
150 |
caatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcc |
218 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
14975164 |
caatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagttttagtgcaccgggttgcc |
14975094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 149 - 224
Target Start/End: Complemental strand, 3116204 - 3116127
Alignment:
| Q |
149 |
acaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||| ||| ||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
3116204 |
acaatacaccaaaaatggtgggaccccttctcggaccttgcgtatgcgggagctttagtacaccggattgcccttttt |
3116127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 107 - 220
Target Start/End: Complemental strand, 23240937 - 23240826
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||| || |||||||| ||||| ||||||||||||||| |||| ||| |||||||||||||||||| |
|
|
| T |
23240937 |
ctggaaacagcctcttgtgtaaaaca--gggtaagtttgcgtacaatataccaattggtgggaccccttctaggacaatgcgtatgcgggagctttagtg |
23240840 |
T |
 |
| Q |
207 |
caccgggttgccct |
220 |
Q |
| |
|
||| ||| |||||| |
|
|
| T |
23240839 |
cactgggctgccct |
23240826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 120 - 224
Target Start/End: Complemental strand, 24751176 - 24751066
Alignment:
| Q |
120 |
cttgtgtaaaaaatagggtaagactgtgtacaatacac-caaatggtgggaccccttcccggaccctgcatatgcg-----ggagctttagtgcaccggg |
213 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||| ||||||||| || ||| ||| |||||| | ||||||||||||||||| |
|
|
| T |
24751176 |
cttgtgtaaaaaatagggtaagactgcgtacaatacactaaaatggtgagaccccttcacgaaccgtgcgtatgcgtatgagcagctttagtgcaccggg |
24751077 |
T |
 |
| Q |
214 |
ttgcccttttt |
224 |
Q |
| |
|
||||| ||||| |
|
|
| T |
24751076 |
ttgccattttt |
24751066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 154 - 222
Target Start/End: Complemental strand, 10734974 - 10734905
Alignment:
| Q |
154 |
acaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| ||||||||||||||||| ||||||| |||||||| |
|
|
| T |
10734974 |
acaccaaagtggtgggcccccttcccggaccctgcgtatgcgggagctttagtccaccgggctgcccttt |
10734905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 108 - 225
Target Start/End: Original strand, 20400688 - 20400805
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||| ||||| ||||| |||| | ||||||| || ||| ||||| | ||||| | | ||||||||| |
|
|
| T |
20400688 |
tggaaacaatctcttgtgtaaaaaacagggtaagactgcgtacagtacactaaatagcgggacccttttccgaaccctacgtatgcagaaactttagtgc |
20400787 |
T |
 |
| Q |
208 |
accgggttgcccttttta |
225 |
Q |
| |
|
|||| ||| |||||||| |
|
|
| T |
20400788 |
accgaattgtccttttta |
20400805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 119 - 200
Target Start/End: Original strand, 14553543 - 14553626
Alignment:
| Q |
119 |
tcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagct |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||| ||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
14553543 |
tcttgtgtaaaaaatagggtaaggctgtgtataatacaccaaaactggtgggaccccttcgtagaccctgtgtatgcgggagct |
14553626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 110 - 190
Target Start/End: Original strand, 6024256 - 6024338
Alignment:
| Q |
110 |
gaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacca--aatggtgggaccccttcccggaccctgcata |
190 |
Q |
| |
|
||||||| ||||||||||||||| | |||||||||| ||||||||||||| |||| ||||||| |||||||||||| ||||| |
|
|
| T |
6024256 |
gaaacagcctcttgtgtaaaaaacatggtaagactgcgtacaatacaccaataatgatgggacctcttcccggaccccgcata |
6024338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 134 - 222
Target Start/End: Original strand, 17432393 - 17432483
Alignment:
| Q |
134 |
agggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
|||||||| ||||||||||||||| ||| ||||| |||| |||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17432393 |
agggtaaggctgtgtacaatacactaaaaatggtgagaccttttcccggatcctgtgcatgcgggagctttagtgcaccgggttgcccttt |
17432483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 111 - 224
Target Start/End: Complemental strand, 9671196 - 9671082
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
209 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||| ||| |||| |||| |||| ||||||||| ||| |||||||| || ||||||||||| |||| |
|
|
| T |
9671196 |
aaacagcctcttgtgtaaaaaacagggtaaggctgcctactttacatcaaaatggtaggacccctttccgaaccctgcaaatacgggagctttaatgcat |
9671097 |
T |
 |
| Q |
210 |
cgggttgcccttttt |
224 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
9671096 |
cgggctgcccttttt |
9671082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 108 - 225
Target Start/End: Original strand, 12228379 - 12228496
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||||| ||||||| ||||||||||| ||| || ||||||||||||| || ||||||||||||||| | ||| | || | ||||| ||||||| |
|
|
| T |
12228379 |
tggaaacagactcttgtttaaaaaataggataaagttgcgtacaatacaccagatagtgggaccccttcccataacctacgtaagtgggagttttagtgt |
12228478 |
T |
 |
| Q |
208 |
accgggttgcccttttta |
225 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
12228479 |
actgggttgcccttttta |
12228496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 107 - 223
Target Start/End: Original strand, 28007648 - 28007761
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||| || ||||||||||||| | |||| || ||| ||||||||||||||||| |||||||||||||| | ||| ||||||||| |||| ||||| |
|
|
| T |
28007648 |
ctggaaagagcctcttgtgtaaaaca--gggtcaggctgcgtacaatacaccaaatgctgggaccccttccc-taacctccatatgcggaagctctagtg |
28007744 |
T |
 |
| Q |
207 |
caccgggttgccctttt |
223 |
Q |
| |
|
|||||| || ||||||| |
|
|
| T |
28007745 |
caccggattaccctttt |
28007761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 11395827 - 11395886
Alignment:
| Q |
154 |
acaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgg |
212 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
11395827 |
acaccaaagtggtgggaccccttcccggatcctgcgtatgcgggagctttagtccaccgg |
11395886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 169 - 224
Target Start/End: Complemental strand, 30786427 - 30786372
Alignment:
| Q |
169 |
accccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||| ||||| ||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30786427 |
accccttcctggaccgtgcgtatgcgggagctttagtgcaccgggttgcctttttt |
30786372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 148 - 198
Target Start/End: Original strand, 22967237 - 22967287
Alignment:
| Q |
148 |
tacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggag |
198 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
22967237 |
tacaatacaccaaatggtgggaccccttcttggaccctgcctatgcgggag |
22967287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 148 - 198
Target Start/End: Complemental strand, 23821156 - 23821106
Alignment:
| Q |
148 |
tacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggag |
198 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
23821156 |
tacaatacaccaaatggtgggaccccttcttggaccctgcctatgcgggag |
23821106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 225
Target Start/End: Complemental strand, 33922916 - 33922854
Alignment:
| Q |
163 |
ggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttta |
225 |
Q |
| |
|
||||| ||||||||||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
33922916 |
ggtggcaccccttcccggaccctgcttatgttggagctttagtgcacatggttgcccttttta |
33922854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 118 - 219
Target Start/End: Complemental strand, 13905083 - 13904984
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgc |
217 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||| ||||||||||| |||||| |||||| ||||||| ||| |||||||| |||||||||| ||| |
|
|
| T |
13905083 |
ctcttgtgtaaaaaacagggtaaggctgcatacaattcaccaaatggt-ggaccctttcccgaaccctgcgtatcacggagcttt-gtgcaccgggctgc |
13904986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 151 - 220
Target Start/End: Complemental strand, 15865928 - 15865859
Alignment:
| Q |
151 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccct |
220 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| | |||| || || |||||||| | |||||||| |
|
|
| T |
15865928 |
aatacaccaaatggtgggaccccttcctggaccctgcgtttgcgtgatctatagtgcactgagttgccct |
15865859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 111 - 222
Target Start/End: Original strand, 12889450 - 12889562
Alignment:
| Q |
111 |
aaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacacc-aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcac |
209 |
Q |
| |
|
|||||| ||||||||| ||||| |||| ||| ||| ||||||||||| ||| | ||||||||||| ||||||||| | || ||||||||||||||| |
|
|
| T |
12889450 |
aaacagcctcttgtgttaaaaacagggcaaggctgcatacaatacacctaaacgatgggacccctttccggaccctctgtgtgtgggagctttagtgcat |
12889549 |
T |
 |
| Q |
210 |
cgggttgcccttt |
222 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
12889550 |
cgggctgcccttt |
12889562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 118 - 213
Target Start/End: Original strand, 19340859 - 19340954
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccggg |
213 |
Q |
| |
|
||||||||||||||| |||||||| || ||||||||||||| || ||||||||||||| |||||| || ||||||| |||||||||||| |||| |
|
|
| T |
19340859 |
ctcttgtgtaaaaaacagggtaaggttgca-acaatacaccaaaatgatgggaccccttcctggacccggcgtatgcggaagctttagtgcaacggg |
19340954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 128 - 221
Target Start/End: Complemental strand, 2755518 - 2755422
Alignment:
| Q |
128 |
aaaaatagggtaagactgtgtacaatacacc--aaatggtgggaccccttcccggaccctgcatat--gcgggagctttagtgcaccgggttgccctt |
221 |
Q |
| |
|
||||||||| |||| ||| |||||||||||| ||||||||||| ||||||| | ||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
2755518 |
aaaaataggctaaggctgcgtacaatacaccaaaaatggtgggagtccttcccaaatcctgcatatgcgcgggagctttagtgcacc-ggttgccctt |
2755422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 187 - 225
Target Start/End: Original strand, 25997749 - 25997787
Alignment:
| Q |
187 |
catatgcgggagctttagtgcaccgggttgcccttttta |
225 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25997749 |
catatgcgggagctctagtgcaccgggttgcccttttta |
25997787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 159 - 215
Target Start/End: Complemental strand, 16895761 - 16895704
Alignment:
| Q |
159 |
aaatggtgggacccc-ttcccggaccctgcatatgcgggagctttagtgcaccgggtt |
215 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||| || || |||||||||||||||| |
|
|
| T |
16895761 |
aaatggtgggacccccttcccggaccctacatatgtggaagttttagtgcaccgggtt |
16895704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 167 - 224
Target Start/End: Complemental strand, 20906841 - 20906784
Alignment:
| Q |
167 |
ggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||| ||| ||||| |||||| |
|
|
| T |
20906841 |
ggaccccttcccagaccccgcatatgcgggagctttagtgaaccaagttgctcttttt |
20906784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 106 - 182
Target Start/End: Original strand, 3564832 - 3564907
Alignment:
| Q |
106 |
tctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggac |
182 |
Q |
| |
|
|||| ||| ||||||||||||||||| ||| ||||||||||| |||||||||| |||||| ||||| ||| ||||| |
|
|
| T |
3564832 |
tctgaaaatagtctcttgtgtaaaaa-tagaataagactgtgtgcaatacaccagatggtgagaccctttctcggac |
3564907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 153 - 224
Target Start/End: Original strand, 34850602 - 34850673
Alignment:
| Q |
153 |
tacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
|||| |||||||||| ||||||||||| | ||||| ||| |||||||||||||| ||||||| ||||||| |
|
|
| T |
34850602 |
tacatcaaatggtggaaccccttcccgaatcctgcgtatataggagctttagtgcatcgggttgtccttttt |
34850673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 109 - 222
Target Start/End: Complemental strand, 13628370 - 13628256
Alignment:
| Q |
109 |
ggaaacagtctcttgtgtaaaaaat-agggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
|||||||| ||||||| ||||||| | ||||| | || ||||||||||| |||| | |||||||||| ||| |||| |||||||||| |||||||| |
|
|
| T |
13628370 |
ggaaacagcctcttgtttaaaaaaacaaggtaaaattgcgtacaatacactaaatagcaagaccccttcctagactctgcgtatgcgggagttttagtgc |
13628271 |
T |
 |
| Q |
208 |
accgggttgcccttt |
222 |
Q |
| |
|
|| || ||||||||| |
|
|
| T |
13628270 |
actggattgcccttt |
13628256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 118 - 175
Target Start/End: Original strand, 32068124 - 32068182
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacacc-aaatggtgggacccctt |
175 |
Q |
| |
|
||||||||||||||| ||| ||| |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
32068124 |
ctcttgtgtaaaaaacaggataatgctgtttacaatacaccaaaatggtgggacccctt |
32068182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 107 - 155
Target Start/End: Original strand, 8409263 - 8409311
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatac |
155 |
Q |
| |
|
|||||||| | ||||||||||||||| |||||||| ||| ||||||||| |
|
|
| T |
8409263 |
ctggaaactgcctcttgtgtaaaaaacagggtaaggctgcgtacaatac |
8409311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 127 - 204
Target Start/End: Original strand, 24734682 - 24734760
Alignment:
| Q |
127 |
aaaaaatagggtaagactgtgtacaatacaccaaat--ggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||| |||||||| || |||||||||| |||| ||||||||||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
24734682 |
aaaaaacagggtaaggttgcgtacaatacaacaaaaaaggtgggaccccttcccggatcctgcgtatgc-ggagctttag |
24734760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 167 - 203
Target Start/End: Complemental strand, 29016337 - 29016301
Alignment:
| Q |
167 |
ggaccccttcccggaccctgcatatgcgggagcttta |
203 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
29016337 |
ggaccccttcccagaccctgcgtatgcgggagcttta |
29016301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 108 - 223
Target Start/End: Complemental strand, 48746 - 48633
Alignment:
| Q |
108 |
tggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgc |
207 |
Q |
| |
|
||||||||| ||||||||||||| | ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48746 |
tggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgc |
48649 |
T |
 |
| Q |
208 |
accgggttgccctttt |
223 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
48648 |
accgggttgccctttt |
48633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 107 - 224
Target Start/End: Original strand, 30599 - 30714
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30599 |
ctggaaacagcctcttgtgtaaaaca--gggtagggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg |
30696 |
T |
 |
| Q |
207 |
caccgggttgcccttttt |
224 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30697 |
caccgggttgcccttttt |
30714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 107 - 222
Target Start/End: Original strand, 58997 - 59114
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttag |
204 |
Q |
| |
|
|||||||||| ||||||| ||||||| |||||||||||| ||||||||||||||| ||||||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
58997 |
ctggaaacagcctcttgtataaaaaacagggtaagactgcgtacaatacaccaaaaatggtgggaccccttcccagactctgcgtatgcgggagctttag |
59096 |
T |
 |
| Q |
205 |
tgcaccgggttgcccttt |
222 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
59097 |
tgcatcgggttgcccttt |
59114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 74; Significance: 6e-34; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 118 - 223
Target Start/End: Original strand, 10841 - 10946
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgc |
217 |
Q |
| |
|
||||||||||||||| |||||| | ||| || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
10841 |
ctcttgtgtaaaaaacagggtagggctgcgtccaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcactgggttgc |
10940 |
T |
 |
| Q |
218 |
cctttt |
223 |
Q |
| |
|
||||| |
|
|
| T |
10941 |
tctttt |
10946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 74; Significance: 6e-34; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 135 - 224
Target Start/End: Complemental strand, 24220 - 24131
Alignment:
| Q |
135 |
gggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
24220 |
gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgcccttttt |
24131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 107 - 225
Target Start/End: Complemental strand, 13138 - 13021
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| |||||| ||||||| ||| |||| ||| |||||||||||| ||||||||||||||||||| |||||||| |||||||| ||||||||| |
|
|
| T |
13138 |
ctggaaacagcctcttgcgtaaaaacaagg-taaggctgcgtacaatacaccgaatggtgggaccccttcccagaccctgcgtatgcgggggctttagtg |
13040 |
T |
 |
| Q |
207 |
caccgggttgcccttttta |
225 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
13039 |
caccgggttgcccttttta |
13021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 71; Significance: 4e-32; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 107 - 220
Target Start/End: Complemental strand, 10163 - 10052
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | || |||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
10163 |
ctggaaacagcctcttgtgtaaaacagag--taagactgcgtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtg |
10066 |
T |
 |
| Q |
207 |
caccgggttgccct |
220 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
10065 |
caccgggttgccct |
10052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 107 - 220
Target Start/End: Complemental strand, 20491 - 20380
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | || |||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
20491 |
ctggaaacagcctcttgtgtaaaacagag--taagactgcgtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtg |
20394 |
T |
 |
| Q |
207 |
caccgggttgccct |
220 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
20393 |
caccgggttgccct |
20380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 107 - 222
Target Start/End: Original strand, 11151 - 11264
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||| ||||||||||||| | || |||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11151 |
ctggaaacagcctcttgtgtaaaacaaag--taaggctgcttacaatacaccaaatggtgggacaccttcccggaccctgcatatgcgggagctctagtg |
11248 |
T |
 |
| Q |
207 |
caccgggttgcccttt |
222 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
11249 |
caccaggttgcccttt |
11264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 115 - 222
Target Start/End: Complemental strand, 72974 - 72867
Alignment:
| Q |
115 |
agtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggt |
214 |
Q |
| |
|
|||||||||||||||||| | |||||| ||| |||||||||||||||||| | ||||||||||||| ||||| |||||||||||||||||||||| ||| |
|
|
| T |
72974 |
agtctcttgtgtaaaaaacacggtaaggctgcctacaatacaccaaatggtagtaccccttcccggaacctgcgtatgcgggagctttagtgcaccaggt |
72875 |
T |
 |
| Q |
215 |
tgcccttt |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
72874 |
tgcccttt |
72867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0954 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0954
Description:
Target: scaffold0954; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 107 - 222
Target Start/End: Original strand, 3564 - 3679
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
||||||| || ||||||||||||| ||| |||||| ||| ||| |||||||| |||| ||||||||||||||| ||||||| ||||||| |||||||||| |
|
|
| T |
3564 |
ctggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagctttagtg |
3663 |
T |
 |
| Q |
207 |
caccgggttgcccttt |
222 |
Q |
| |
|
||||| ||| |||||| |
|
|
| T |
3664 |
caccgagtttcccttt |
3679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 148 - 218
Target Start/End: Complemental strand, 1661 - 1591
Alignment:
| Q |
148 |
tacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcc |
218 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||| ||||||| |
|
|
| T |
1661 |
tacaatacaccaaatgatgggaccccttcccggacccggcgtatgcgggagctttagtgcaccaggttgcc |
1591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 135 - 224
Target Start/End: Original strand, 24696 - 24785
Alignment:
| Q |
135 |
gggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttttt |
224 |
Q |
| |
|
||||||||||| ||| |||||||||||| |||| |||||| || |||||||| ||| ||||||||| |||||||| | ||||||||||| |
|
|
| T |
24696 |
gggtaagactgcgtataatacaccaaatagtggaccccctttccagaccctgcgtatacgggagcttcagtgcacctgattgcccttttt |
24785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0167 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0167
Description:
Target: scaffold0167; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 118 - 202
Target Start/End: Original strand, 23630 - 23714
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt |
202 |
Q |
| |
|
||||||||||||||| ||||| || ||| ||||||| | ||||||||||||||||||||| |||| || |||| ||||||||| |
|
|
| T |
23630 |
ctcttgtgtaaaaaacagggtgaggctgcgtacaatgtagcaaatggtgggaccccttcccagaccttgagtatgtgggagcttt |
23714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 35129 - 35062
Alignment:
| Q |
111 |
aaacagtctcttgtgtaa-aaaatagggtaagactgtgtacaatacaccaaatggtgggaccccttcc |
177 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||| |||||||||||||||||||||||||| |||| |
|
|
| T |
35129 |
aaacagtctcttgtgtgtgaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccctttcc |
35062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0867 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0867
Description:
Target: scaffold0867; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 147 - 206
Target Start/End: Complemental strand, 3744 - 3685
Alignment:
| Q |
147 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtg |
206 |
Q |
| |
|
|||||||||||||||||||||||||| || | || | || ||||||||||||||||||| |
|
|
| T |
3744 |
gtacaatacaccaaatggtgggacccttttctcgatcttgtatatgcgggagctttagtg |
3685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 107 - 185
Target Start/End: Original strand, 4177 - 4258
Alignment:
| Q |
107 |
ctggaaacagtctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa---tggtgggaccccttcccggaccct |
185 |
Q |
| |
|
||||||||| ||||||||||||| | ||| |||| || |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4177 |
ctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataattggtgggaccccttcccggaccct |
4258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 118 - 172
Target Start/End: Original strand, 32961 - 33016
Alignment:
| Q |
118 |
ctcttgtgtaaaaaatagggtaagactgtgtacaatacaccaaa-tggtgggaccc |
172 |
Q |
| |
|
||||| ||||||||| || |||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
32961 |
ctcttctgtaaaaaacagagtaagactgtatacaatacaccaaattggtgggaccc |
33016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 152 - 222
Target Start/End: Complemental strand, 58699 - 58630
Alignment:
| Q |
152 |
atacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgcccttt |
222 |
Q |
| |
|
||||||| ||||||| ||||||||| ||||||||| |||||||||||| | ||||||| || |||||||| |
|
|
| T |
58699 |
atacaccgaatggtgagaccccttctcggaccctgtgtatgcgggagctct-gtgcaccaggctgcccttt |
58630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University