View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19757_low_82 (Length: 299)
Name: NF19757_low_82
Description: NF19757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19757_low_82 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 299
Target Start/End: Complemental strand, 39941145 - 39940861
Alignment:
| Q |
16 |
atcattactaaaagaggagtcacttatatcttcgtcactttcactttcaatggttgctaggtttgtgactgttgttctctctaactcttgttcttgcaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39941145 |
atcattactaaaagaggagtcacttatatcttcgtcactttcactttcaatggttgctaggtttgtgaatgttgttctctctaactcttgttcttgcaag |
39941046 |
T |
 |
| Q |
116 |
ccaattgctaaaacaaaatcggagctaacttcctcaagttcagtgtatggannnnnnncggaagattgttttccctcttcgcgttccattgaagaag-nn |
214 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39941045 |
ccaattgctagaacaaaatcagagctaacttcctcaagttcagtgtatggatttttttcggaagattgttttccctcttcacgttccattgaagaagaaa |
39940946 |
T |
 |
| Q |
215 |
nnnnnggtattacgatacgattgagggaatgagaatagaacacgaccattgaggtatttgaggagatgaacatatagaagcataa |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39940945 |
aaaaaggtattacgatacgattgagggaatgagaatagaacacgacccttgaggtatttgaggagatgaacatatagaagcataa |
39940861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University