View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19757_low_83 (Length: 297)
Name: NF19757_low_83
Description: NF19757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19757_low_83 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 16 - 287
Target Start/End: Original strand, 39813417 - 39813688
Alignment:
| Q |
16 |
catttcatacaaaataaatgatcctagcaaggtaagtgaaatttactaataccttctcataccgacacatattaagtgcatggttggtattacggtgcat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
39813417 |
catttcatacaaaataaatgatcctagcaaggtaagtgaaatttactaataccttctcataccgacacagattaagtgcatggttggtattacggtccat |
39813516 |
T |
 |
| Q |
116 |
ttgccaaatcaaggtggctcaccgtgattctgataaactcaccgtgaatcaaaacatgctgtaacacttagaaattgattgaaattgttctataaattgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39813517 |
ttgccaaatcaaggtggctcaccgtgattctgataaactcaccgtgaatcaaaacatgctgtaacacttagaaattgattgaaattgttctataaattgt |
39813616 |
T |
 |
| Q |
216 |
tcgttttaggcaaggaaggttgatgacttgaggcaaaagcttcggatgagaggtctacgttgccatcctatg |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39813617 |
tcgttttaggcaaggaaggttgatgacttgaggcaaaagcttcggatgagaggtctacgttgccatcctatg |
39813688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 234 - 287
Target Start/End: Original strand, 15801849 - 15801902
Alignment:
| Q |
234 |
gttgatgacttgaggcaaaagcttcggatgagaggtctacgttgccatcctatg |
287 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||| ||||| || ||||||||| |
|
|
| T |
15801849 |
gttgatgacttgaggcagaagcttcgcatgcgaggcctacgatgtcatcctatg |
15801902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 115 - 156
Target Start/End: Complemental strand, 38425383 - 38425342
Alignment:
| Q |
115 |
tttgccaaatcaaggtggctcaccgtgattctgataaactca |
156 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
38425383 |
tttgccaaatcacggtggctcaacgtgattctgacaaactca |
38425342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University