View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19757_low_87 (Length: 286)

Name: NF19757_low_87
Description: NF19757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19757_low_87
NF19757_low_87
[»] chr5 (71 HSPs)
chr5 (118-272)||(1162298-1162452)
chr5 (3-181)||(1850662-1850840)
chr5 (1-118)||(24448910-24449028)
chr5 (1-116)||(41014339-41014454)
chr5 (1-116)||(32703444-32703558)
chr5 (1-118)||(19142940-19143057)
chr5 (130-248)||(39880615-39880729)
chr5 (130-248)||(40412704-40412818)
chr5 (1-116)||(38879601-38879719)
chr5 (1-118)||(35710333-35710449)
chr5 (1-117)||(8169982-8170097)
chr5 (5-103)||(7097772-7097870)
chr5 (1-117)||(43334222-43334341)
chr5 (1-106)||(43574626-43574732)
chr5 (40-116)||(16957374-16957450)
chr5 (186-272)||(3300186-3300270)
chr5 (186-272)||(3393079-3393163)
chr5 (1-112)||(7368418-7368528)
chr5 (6-115)||(16880647-16880757)
chr5 (27-115)||(34154814-34154902)
chr5 (1-116)||(4619103-4619221)
chr5 (1-115)||(13801767-13801884)
chr5 (2-115)||(5873322-5873435)
chr5 (1-114)||(12006329-12006445)
chr5 (1-114)||(20135624-20135740)
chr5 (1-116)||(29334415-29334532)
chr5 (4-92)||(2838802-2838890)
chr5 (1-119)||(1405207-1405326)
chr5 (1-116)||(27328772-27328890)
chr5 (1-106)||(208936-209042)
chr5 (21-116)||(3771380-3771475)
chr5 (1-115)||(12575660-12575777)
chr5 (53-115)||(25622533-25622595)
chr5 (1-115)||(1565451-1565566)
chr5 (2-116)||(28516432-28516548)
chr5 (170-272)||(40419663-40419760)
chr5 (1-95)||(22600474-22600569)
chr5 (5-111)||(30006349-30006456)
chr5 (30-123)||(11657691-11657785)
chr5 (56-118)||(16028621-16028683)
chr5 (1-95)||(24323725-24323820)
chr5 (1-95)||(24360349-24360444)
chr5 (1-87)||(41425968-41426055)
chr5 (6-106)||(39301148-39301249)
chr5 (45-118)||(10943842-10943914)
chr5 (37-106)||(13774922-13774991)
chr5 (55-116)||(39801591-39801652)
chr5 (52-112)||(21784335-21784395)
chr5 (64-116)||(32354211-32354263)
chr5 (7-118)||(37225958-37226070)
chr5 (42-96)||(10306493-10306548)
chr5 (4-67)||(22907913-22907976)
chr5 (56-115)||(30877564-30877623)
chr5 (42-116)||(22861668-22861742)
chr5 (31-103)||(12477132-12477205)
chr5 (5-117)||(24903694-24903807)
chr5 (5-115)||(42924830-42924945)
chr5 (52-118)||(19093885-19093951)
chr5 (40-111)||(39079755-39079827)
chr5 (50-93)||(21542489-21542532)
chr5 (31-116)||(24313571-24313658)
chr5 (31-116)||(24355908-24355995)
chr5 (30-102)||(3176770-3176839)
chr5 (21-103)||(31694120-31694202)
chr5 (5-101)||(18426063-18426160)
chr5 (73-114)||(29184062-29184103)
chr5 (74-118)||(18099955-18099999)
chr5 (4-106)||(34074573-34074674)
chr5 (52-103)||(4654427-4654478)
chr5 (22-105)||(9794388-9794471)
chr5 (68-110)||(18684361-18684403)
[»] scaffold0057 (4 HSPs)
scaffold0057 (1-118)||(46851-46969)
scaffold0057 (6-118)||(24769-24882)
scaffold0057 (1-116)||(43679-43794)
scaffold0057 (27-119)||(46703-46796)
[»] chr3 (83 HSPs)
chr3 (1-120)||(40272807-40272927)
chr3 (2-114)||(22609809-22609921)
chr3 (1-117)||(54484732-54484850)
chr3 (1-118)||(26869749-26869866)
chr3 (1-116)||(13628789-13628907)
chr3 (1-117)||(1217132-1217247)
chr3 (4-115)||(39203561-39203671)
chr3 (1-115)||(31592891-31593004)
chr3 (11-120)||(15797274-15797382)
chr3 (1-105)||(45948848-45948953)
chr3 (2-123)||(54374337-54374460)
chr3 (5-115)||(45786214-45786327)
chr3 (1-118)||(46421031-46421152)
chr3 (1-118)||(13730599-13730719)
chr3 (1-114)||(22122918-22123030)
chr3 (2-119)||(49013469-49013589)
chr3 (4-116)||(16735486-16735598)
chr3 (30-118)||(52926216-52926304)
chr3 (1-117)||(5173717-5173835)
chr3 (5-104)||(6411833-6411932)
chr3 (1-116)||(29366719-29366837)
chr3 (22-117)||(34771362-34771457)
chr3 (1-115)||(10795423-10795540)
chr3 (2-117)||(53996563-53996680)
chr3 (1-116)||(12914034-12914150)
chr3 (1-117)||(516451-516571)
chr3 (1-118)||(8247683-8247804)
chr3 (1-115)||(14986999-14987116)
chr3 (1-116)||(25517169-25517286)
chr3 (1-118)||(26573169-26573287)
chr3 (21-113)||(353351-353445)
chr3 (1-117)||(34420641-34420759)
chr3 (5-79)||(47624088-47624162)
chr3 (49-118)||(24851298-24851367)
chr3 (4-120)||(50624948-50625065)
chr3 (1-99)||(33926125-33926224)
chr3 (1-118)||(7943032-7943150)
chr3 (4-119)||(829438-829555)
chr3 (11-115)||(9276316-9276419)
chr3 (2-114)||(45139479-45139592)
chr3 (55-121)||(30452892-30452958)
chr3 (60-116)||(10484615-10484671)
chr3 (1-111)||(19731044-19731155)
chr3 (40-118)||(25944551-25944630)
chr3 (67-118)||(47624208-47624259)
chr3 (1-116)||(54032570-54032674)
chr3 (11-117)||(26292384-26292489)
chr3 (21-119)||(4495672-4495758)
chr3 (1-114)||(7696893-7697000)
chr3 (1-101)||(43114882-43114985)
chr3 (11-117)||(44403553-44403661)
chr3 (1-111)||(19751620-19751731)
chr3 (40-119)||(24577917-24577996)
chr3 (40-119)||(24578007-24578086)
chr3 (1-95)||(30928167-30928262)
chr3 (1-98)||(9607245-9607345)
chr3 (50-119)||(35417996-35418065)
chr3 (1-115)||(31831241-31831343)
chr3 (74-118)||(40390357-40390401)
chr3 (5-111)||(55401222-55401330)
chr3 (1-114)||(31904857-31904972)
chr3 (1-106)||(52428479-52428592)
chr3 (11-114)||(33235583-33235687)
chr3 (55-115)||(14266372-14266431)
chr3 (5-68)||(29106595-29106659)
chr3 (1-62)||(45620881-45620944)
chr3 (1-118)||(12525449-12525567)
chr3 (72-118)||(43956469-43956515)
chr3 (69-118)||(6242282-6242331)
chr3 (1-55)||(21875055-21875111)
chr3 (44-101)||(46169981-46170038)
chr3 (61-118)||(51644074-51644131)
chr3 (76-115)||(23871484-23871523)
chr3 (40-115)||(28905026-28905100)
chr3 (59-114)||(45288056-45288111)
chr3 (56-118)||(10696210-10696272)
chr3 (64-118)||(19325184-19325238)
chr3 (62-116)||(45416933-45416986)
chr3 (1-42)||(10870025-10870066)
chr3 (51-115)||(4835835-4835899)
chr3 (50-118)||(10300583-10300651)
chr3 (16-96)||(19349808-19349888)
chr3 (52-116)||(40968612-40968676)
[»] chr4 (90 HSPs)
chr4 (1-117)||(5648279-5648395)
chr4 (2-114)||(6430627-6430739)
chr4 (1-118)||(20639655-20639774)
chr4 (1-115)||(20225004-20225117)
chr4 (1-118)||(30639400-30639517)
chr4 (1-117)||(25629069-25629186)
chr4 (1-114)||(40915849-40915962)
chr4 (1-118)||(5306657-5306778)
chr4 (1-114)||(7909281-7909395)
chr4 (1-118)||(47528527-47528643)
chr4 (1-117)||(48598823-48598938)
chr4 (11-118)||(23501817-23501927)
chr4 (11-113)||(29207900-29208001)
chr4 (1-118)||(47443977-47444095)
chr4 (5-117)||(54175088-54175202)
chr4 (4-116)||(14983857-14983970)
chr4 (5-117)||(9832311-9832422)
chr4 (1-118)||(9987831-9987949)
chr4 (2-119)||(35567191-35567309)
chr4 (1-118)||(16408598-16408718)
chr4 (4-116)||(16911585-16911700)
chr4 (5-116)||(51865037-51865149)
chr4 (1-112)||(21646984-21647098)
chr4 (12-118)||(11054145-11054250)
chr4 (21-115)||(30690176-30690270)
chr4 (1-94)||(49796818-49796911)
chr4 (27-115)||(20225121-20225211)
chr4 (1-118)||(17043392-17043509)
chr4 (1-115)||(32478792-32478900)
chr4 (44-118)||(38786673-38786747)
chr4 (5-115)||(44363130-44363243)
chr4 (1-105)||(19027868-19027973)
chr4 (1-117)||(25463142-25463258)
chr4 (1-101)||(37494871-37494972)
chr4 (1-118)||(39077793-39077909)
chr4 (1-102)||(41018807-41018908)
chr4 (37-118)||(30352577-30352660)
chr4 (41-118)||(33836484-33836563)
chr4 (1-114)||(8473621-8473735)
chr4 (11-117)||(13256397-13256506)
chr4 (29-118)||(20908633-20908723)
chr4 (53-115)||(38755908-38755970)
chr4 (2-99)||(30581481-30581581)
chr4 (4-119)||(54730272-54730391)
chr4 (51-115)||(11394923-11394987)
chr4 (51-115)||(11404650-11404714)
chr4 (54-118)||(32484307-32484371)
chr4 (13-115)||(55766466-55766568)
chr4 (4-117)||(10277755-10277867)
chr4 (4-115)||(20405109-20405224)
chr4 (54-115)||(40553937-40553998)
chr4 (1-92)||(7385499-7385591)
chr4 (1-112)||(54967041-54967151)
chr4 (1-110)||(21489107-21489218)
chr4 (53-115)||(25388249-25388311)
chr4 (37-118)||(36816381-36816463)
chr4 (65-118)||(35532077-35532130)
chr4 (2-115)||(55830721-55830834)
chr4 (5-114)||(12711450-12711561)
chr4 (4-116)||(7038075-7038188)
chr4 (1-118)||(10660424-10660544)
chr4 (1-118)||(10874569-10874689)
chr4 (2-104)||(30496333-30496434)
chr4 (12-105)||(47441540-47441634)
chr4 (2-97)||(39029078-39029175)
chr4 (54-115)||(44718641-44718702)
chr4 (53-118)||(50555653-50555718)
chr4 (52-116)||(47482849-47482913)
chr4 (1-97)||(49938611-49938705)
chr4 (55-120)||(19027986-19028051)
chr4 (9-95)||(3580860-3580947)
chr4 (51-118)||(28494222-28494289)
chr4 (2-106)||(487135-487249)
chr4 (64-117)||(56322984-56323037)
chr4 (27-115)||(2813172-2813263)
chr4 (5-61)||(10379997-10380053)
chr4 (22-106)||(16494259-16494345)
chr4 (12-115)||(48327763-48327869)
chr4 (12-118)||(25343218-25343327)
chr4 (29-74)||(35894502-35894548)
chr4 (53-118)||(8820581-8820646)
chr4 (1-112)||(36589763-36589876)
chr4 (58-114)||(12666858-12666914)
chr4 (4-99)||(32629285-32629380)
chr4 (2-52)||(51420595-51420646)
chr4 (2-75)||(17079691-17079765)
chr4 (2-40)||(42164224-42164262)
chr4 (66-103)||(37038135-37038172)
chr4 (54-114)||(21003410-21003469)
chr4 (44-118)||(48033388-48033464)
[»] chr2 (72 HSPs)
chr2 (1-116)||(9671201-9671315)
chr2 (1-118)||(14444749-14444866)
chr2 (1-118)||(36871513-36871629)
chr2 (1-116)||(8455315-8455431)
chr2 (1-118)||(10546182-10546301)
chr2 (2-118)||(25249735-25249851)
chr2 (1-119)||(17668022-17668141)
chr2 (1-116)||(21779260-21779374)
chr2 (1-115)||(10543718-10543835)
chr2 (4-119)||(17623587-17623703)
chr2 (4-117)||(17896282-17896397)
chr2 (1-115)||(14530338-14530455)
chr2 (1-115)||(23397786-23397899)
chr2 (4-115)||(25079717-25079830)
chr2 (1-115)||(40762234-40762349)
chr2 (1-116)||(39914305-39914421)
chr2 (1-118)||(24859985-24860101)
chr2 (1-116)||(11514456-11514571)
chr2 (1-105)||(12023929-12024033)
chr2 (2-118)||(30826058-30826173)
chr2 (1-116)||(24200622-24200740)
chr2 (2-115)||(17380238-17380350)
chr2 (4-116)||(5841051-5841166)
chr2 (1-119)||(19977710-19977829)
chr2 (3-95)||(32781308-32781401)
chr2 (21-116)||(44643564-44643659)
chr2 (4-117)||(21377072-21377185)
chr2 (21-115)||(25632550-25632644)
chr2 (10-117)||(26684618-26684727)
chr2 (4-112)||(4516354-4516463)
chr2 (1-118)||(25641522-25641639)
chr2 (1-79)||(22371077-22371153)
chr2 (6-117)||(27573646-27573757)
chr2 (2-105)||(30864427-30864530)
chr2 (29-102)||(24890460-24890533)
chr2 (55-120)||(34766330-34766395)
chr2 (52-116)||(23488555-23488619)
chr2 (7-103)||(39499242-39499338)
chr2 (54-114)||(40579750-40579810)
chr2 (2-115)||(40416871-40416985)
chr2 (29-114)||(13245096-13245181)
chr2 (55-116)||(34080176-34080237)
chr2 (1-78)||(5450305-5450384)
chr2 (1-115)||(14544083-14544201)
chr2 (54-118)||(41409936-41410000)
chr2 (21-103)||(31821355-31821437)
chr2 (67-116)||(22371199-22371248)
chr2 (2-118)||(7214555-7214674)
chr2 (5-117)||(31158437-31158552)
chr2 (32-99)||(99281-99348)
chr2 (60-115)||(8575975-8576030)
chr2 (3-95)||(33795307-33795400)
chr2 (3-118)||(15296403-15296520)
chr2 (67-111)||(124918-124962)
chr2 (5-103)||(44449395-44449495)
chr2 (24-120)||(45235812-45235908)
chr2 (44-99)||(24059012-24059067)
chr2 (61-115)||(3633708-3633762)
chr2 (12-77)||(23145736-23145802)
chr2 (12-77)||(23557526-23557592)
chr2 (4-105)||(17471571-17471675)
chr2 (53-116)||(1289095-1289159)
chr2 (52-115)||(19185743-19185806)
chr2 (4-103)||(19615015-19615116)
chr2 (45-112)||(31525771-31525838)
chr2 (45-107)||(31523296-31523358)
chr2 (64-118)||(39189501-39189555)
chr2 (49-102)||(4794871-4794924)
chr2 (37-116)||(4795811-4795891)
chr2 (2-96)||(44521392-44521487)
chr2 (1-34)||(44604874-44604907)
chr2 (46-74)||(4252656-4252684)
[»] chr8 (62 HSPs)
chr8 (1-114)||(45071285-45071398)
chr8 (4-115)||(13160725-13160836)
chr8 (1-119)||(35261699-35261818)
chr8 (2-116)||(44530170-44530285)
chr8 (1-117)||(28817624-28817741)
chr8 (1-116)||(36720816-36720932)
chr8 (1-118)||(8897761-8897879)
chr8 (1-116)||(12625909-12626026)
chr8 (1-118)||(12670247-12670363)
chr8 (1-118)||(7136524-7136644)
chr8 (1-118)||(30454094-30454210)
chr8 (1-117)||(18164758-18164874)
chr8 (1-121)||(39460988-39461111)
chr8 (1-117)||(5135288-5135404)
chr8 (1-113)||(29877114-29877227)
chr8 (1-115)||(29521685-29521800)
chr8 (5-116)||(31457197-31457308)
chr8 (1-118)||(6760842-6760962)
chr8 (1-118)||(20869943-20870063)
chr8 (1-106)||(8483947-8484053)
chr8 (11-117)||(10857858-10857966)
chr8 (41-118)||(26102578-26102655)
chr8 (1-109)||(20284075-20284188)
chr8 (1-117)||(25250542-25250661)
chr8 (1-115)||(17823596-17823711)
chr8 (21-109)||(21070703-21070793)
chr8 (1-117)||(44742516-44742634)
chr8 (1-116)||(26954152-26954271)
chr8 (11-110)||(5689661-5689761)
chr8 (4-104)||(24365071-24365172)
chr8 (1-118)||(389663-389783)
chr8 (22-116)||(19729382-19729476)
chr8 (1-115)||(23000228-23000333)
chr8 (1-115)||(2626539-2626657)
chr8 (1-102)||(44781517-44781621)
chr8 (48-115)||(28407471-28407538)
chr8 (21-115)||(16225060-16225156)
chr8 (1-103)||(22598177-22598279)
chr8 (24-117)||(26457773-26457864)
chr8 (66-118)||(27468089-27468141)
chr8 (52-116)||(35107310-35107374)
chr8 (37-117)||(16013511-16013593)
chr8 (55-114)||(27507985-27508044)
chr8 (1-92)||(20869523-20869611)
chr8 (1-112)||(17250879-17250992)
chr8 (1-78)||(35105943-35106022)
chr8 (54-114)||(36486567-36486627)
chr8 (2-116)||(40604905-40605019)
chr8 (1-114)||(42083699-42083814)
chr8 (60-118)||(18595918-18595976)
chr8 (2-94)||(14017989-14018083)
chr8 (11-65)||(23286375-23286428)
chr8 (5-71)||(43942348-43942417)
chr8 (66-115)||(33867038-33867087)
chr8 (59-116)||(40444845-40444902)
chr8 (52-119)||(2351717-2351781)
chr8 (31-79)||(11000985-11001033)
chr8 (52-96)||(24245521-24245565)
chr8 (71-115)||(30962771-30962815)
chr8 (65-116)||(27635064-27635115)
chr8 (58-118)||(2677618-2677678)
chr8 (24-56)||(28873242-28873274)
[»] chr7 (75 HSPs)
chr7 (1-113)||(18512455-18512567)
chr7 (1-118)||(7879658-7879776)
chr7 (1-116)||(21172008-21172122)
chr7 (1-118)||(32758281-32758397)
chr7 (1-118)||(34626205-34626322)
chr7 (1-118)||(42391097-42391213)
chr7 (2-115)||(48735122-48735234)
chr7 (1-115)||(2541019-2541134)
chr7 (1-115)||(10693073-10693186)
chr7 (1-114)||(11617589-11617703)
chr7 (1-111)||(33871914-33872024)
chr7 (1-107)||(38604547-38604654)
chr7 (6-116)||(35787268-35787378)
chr7 (1-117)||(27629654-27629771)
chr7 (12-116)||(40463908-40464012)
chr7 (1-117)||(42805544-42805663)
chr7 (32-119)||(27889312-27889399)
chr7 (1-116)||(31591108-31591222)
chr7 (1-118)||(19426887-19427004)
chr7 (1-115)||(47716479-47716596)
chr7 (14-118)||(19265848-19265951)
chr7 (2-117)||(42798690-42798806)
chr7 (1-118)||(38262193-38262311)
chr7 (1-118)||(43557492-43557613)
chr7 (22-114)||(11741835-11741927)
chr7 (2-114)||(18747507-18747621)
chr7 (4-114)||(29907442-29907552)
chr7 (1-118)||(32233132-32233249)
chr7 (21-113)||(35334818-35334910)
chr7 (1-115)||(23231577-23231692)
chr7 (1-115)||(23419674-23419789)
chr7 (1-123)||(13805122-13805243)
chr7 (1-118)||(1408477-1408595)
chr7 (21-94)||(19266491-19266564)
chr7 (1-114)||(42476893-42477005)
chr7 (1-118)||(47077852-47077968)
chr7 (1-105)||(2662946-2663048)
chr7 (1-77)||(46354214-46354293)
chr7 (5-101)||(8148960-8149057)
chr7 (32-115)||(45018923-45019010)
chr7 (12-115)||(22698967-22699074)
chr7 (2-113)||(22065609-22065720)
chr7 (12-102)||(21139761-21139851)
chr7 (37-106)||(21566492-21566562)
chr7 (12-116)||(39123921-39124031)
chr7 (40-117)||(23618975-23619052)
chr7 (29-106)||(28362155-28362231)
chr7 (21-114)||(3469176-3469271)
chr7 (4-114)||(16341301-16341413)
chr7 (68-118)||(36602535-36602585)
chr7 (37-105)||(36267827-36267896)
chr7 (1-91)||(14099030-14099121)
chr7 (1-91)||(14409047-14409138)
chr7 (21-96)||(28078151-28078226)
chr7 (1-91)||(48123508-48123599)
chr7 (52-122)||(45811919-45811988)
chr7 (41-117)||(13792148-13792225)
chr7 (52-112)||(33500587-33500645)
chr7 (1-118)||(44123620-44123736)
chr7 (38-118)||(25198784-25198864)
chr7 (64-112)||(42495865-42495913)
chr7 (1-90)||(7644976-7645066)
chr7 (37-116)||(23065924-23066003)
chr7 (1-113)||(27697457-27697572)
chr7 (27-117)||(39093437-39093528)
chr7 (5-115)||(6736914-6737022)
chr7 (5-54)||(12473328-12473378)
chr7 (84-118)||(44171634-44171668)
chr7 (21-115)||(14732821-14732916)
chr7 (2-62)||(23604553-23604612)
chr7 (21-99)||(17048831-17048910)
chr7 (57-115)||(11888414-11888472)
chr7 (13-71)||(15108441-15108499)
chr7 (55-100)||(42101899-42101944)
chr7 (72-104)||(25434112-25434144)
[»] chr1 (88 HSPs)
chr1 (2-119)||(46247949-46248067)
chr1 (1-119)||(46991847-46991966)
chr1 (21-115)||(4349702-4349796)
chr1 (1-118)||(31382211-31382328)
chr1 (1-116)||(34725097-34725211)
chr1 (1-118)||(18944686-18944807)
chr1 (4-117)||(35253185-35253297)
chr1 (1-116)||(14617081-14617197)
chr1 (1-116)||(10668268-10668386)
chr1 (1-116)||(32632556-32632671)
chr1 (4-119)||(38478278-38478392)
chr1 (1-118)||(6925143-6925261)
chr1 (2-116)||(27474325-27474439)
chr1 (1-118)||(45402137-45402257)
chr1 (4-120)||(11596559-11596674)
chr1 (1-116)||(30395725-30395843)
chr1 (5-116)||(35005170-35005284)
chr1 (1-118)||(23796508-23796626)
chr1 (1-119)||(27201690-27201811)
chr1 (2-110)||(23768325-23768434)
chr1 (1-116)||(12126836-12126950)
chr1 (22-116)||(19414502-19414596)
chr1 (1-93)||(25468285-25468378)
chr1 (31-118)||(1517308-1517395)
chr1 (21-117)||(18741955-18742053)
chr1 (1-116)||(20004089-20004207)
chr1 (21-117)||(42304205-42304303)
chr1 (22-112)||(10378738-10378828)
chr1 (12-118)||(45812534-45812639)
chr1 (1-118)||(47214554-47214670)
chr1 (1-116)||(9939504-9939623)
chr1 (1-116)||(41319805-41319921)
chr1 (1-118)||(2435783-2435902)
chr1 (21-116)||(6983810-6983905)
chr1 (27-118)||(43768209-43768300)
chr1 (1-106)||(44485119-44485224)
chr1 (52-118)||(50606498-50606564)
chr1 (11-118)||(8197096-8197204)
chr1 (5-118)||(19701617-19701732)
chr1 (2-116)||(19974073-19974188)
chr1 (11-78)||(21910686-21910753)
chr1 (2-113)||(22324937-22325049)
chr1 (5-118)||(35019277-35019390)
chr1 (27-104)||(15505634-15505710)
chr1 (32-116)||(20999849-20999933)
chr1 (21-108)||(31442396-31442484)
chr1 (1-117)||(50811982-50812100)
chr1 (1-95)||(18724565-18724660)
chr1 (21-113)||(19932755-19932849)
chr1 (1-117)||(20036263-20036380)
chr1 (1-115)||(35117765-35117883)
chr1 (48-110)||(4587568-4587630)
chr1 (1-118)||(31272378-31272489)
chr1 (1-106)||(34148969-34149075)
chr1 (1-113)||(15511150-15511266)
chr1 (1-112)||(39214961-39215074)
chr1 (1-103)||(45264411-45264515)
chr1 (2-81)||(21723728-21723807)
chr1 (1-80)||(22930104-22930182)
chr1 (52-118)||(30555210-30555276)
chr1 (2-117)||(24564388-24564494)
chr1 (11-95)||(30682867-30682950)
chr1 (4-106)||(23371170-23371271)
chr1 (1-105)||(27136661-27136767)
chr1 (50-116)||(33594130-33594196)
chr1 (38-103)||(4249455-4249520)
chr1 (38-103)||(4249779-4249844)
chr1 (38-103)||(4250103-4250168)
chr1 (2-66)||(33223028-33223093)
chr1 (37-100)||(4430014-4430077)
chr1 (27-117)||(6358191-6358282)
chr1 (21-92)||(20982773-20982844)
chr1 (2-118)||(43207539-43207657)
chr1 (4-113)||(34679217-34679331)
chr1 (4-101)||(17470361-17470458)
chr1 (5-95)||(20169109-20169200)
chr1 (1-98)||(18335305-18335403)
chr1 (61-115)||(25554742-25554796)
chr1 (60-117)||(16120819-16120876)
chr1 (31-112)||(28894561-28894642)
chr1 (68-117)||(50760238-50760287)
chr1 (41-118)||(43921787-43921866)
chr1 (56-115)||(37299573-37299632)
chr1 (52-118)||(41440599-41440665)
chr1 (21-118)||(46859130-46859228)
chr1 (13-61)||(4430080-4430129)
chr1 (52-103)||(1693221-1693273)
chr1 (39-99)||(10158281-10158341)
[»] chr6 (51 HSPs)
chr6 (1-117)||(29355853-29355972)
chr6 (1-116)||(1354756-1354870)
chr6 (1-118)||(1346984-1347100)
chr6 (1-117)||(26097180-26097295)
chr6 (2-116)||(12221913-12222031)
chr6 (1-118)||(9161143-9161262)
chr6 (1-117)||(25557745-25557860)
chr6 (1-119)||(2166406-2166527)
chr6 (1-119)||(2178039-2178160)
chr6 (2-125)||(18277183-18277307)
chr6 (43-117)||(13267788-13267862)
chr6 (1-115)||(7947371-7947487)
chr6 (37-116)||(23930126-23930205)
chr6 (5-118)||(1941879-1941993)
chr6 (1-98)||(32579446-32579543)
chr6 (53-117)||(6808468-6808532)
chr6 (37-118)||(12892064-12892147)
chr6 (37-116)||(12885968-12886049)
chr6 (38-115)||(383760-383837)
chr6 (1-108)||(3815084-3815192)
chr6 (1-113)||(23240826-23240937)
chr6 (1-104)||(33138853-33138957)
chr6 (49-119)||(24097646-24097716)
chr6 (37-118)||(3116126-3116209)
chr6 (1-113)||(15866041-15866152)
chr6 (47-115)||(10734905-10734974)
chr6 (27-115)||(17432393-17432483)
chr6 (2-91)||(22967192-22967287)
chr6 (2-91)||(23821106-23821201)
chr6 (62-118)||(30786371-30786427)
chr6 (47-105)||(11395827-11395886)
chr6 (43-111)||(14975094-14975164)
chr6 (1-116)||(28007648-28007761)
chr6 (2-116)||(32728156-32728270)
chr6 (44-113)||(15865859-15865928)
chr6 (11-106)||(19340858-19340954)
chr6 (21-117)||(12228399-12228495)
chr6 (5-115)||(12889450-12889562)
chr6 (5-112)||(13904984-13905090)
chr6 (5-118)||(9671081-9671196)
chr6 (21-97)||(24734683-24734760)
chr6 (3-99)||(11849075-11849173)
chr6 (56-117)||(33922855-33922916)
chr6 (13-93)||(14553543-14553626)
chr6 (2-117)||(20400688-20400804)
chr6 (46-118)||(34850602-34850674)
chr6 (21-114)||(2755422-2755518)
chr6 (37-115)||(13628256-13628334)
chr6 (83-117)||(25997752-25997786)
chr6 (4-77)||(6024256-6024332)
chr6 (60-96)||(29016301-29016337)
[»] scaffold0015 (1 HSPs)
scaffold0015 (2-116)||(48633-48746)
[»] scaffold0258 (1 HSPs)
scaffold0258 (1-117)||(13022-13138)
[»] scaffold0168 (1 HSPs)
scaffold0168 (1-117)||(30599-30714)
[»] scaffold0311 (1 HSPs)
scaffold0311 (5-116)||(10834-10946)
[»] scaffold0180 (1 HSPs)
scaffold0180 (28-118)||(24130-24220)
[»] scaffold1176 (1 HSPs)
scaffold1176 (5-111)||(1591-1696)
[»] scaffold0223 (1 HSPs)
scaffold0223 (1-115)||(11151-11264)
[»] scaffold0049 (1 HSPs)
scaffold0049 (1-115)||(58997-59114)
[»] scaffold0187 (2 HSPs)
scaffold0187 (1-113)||(10052-10163)
scaffold0187 (1-113)||(20380-20491)
[»] scaffold0018 (1 HSPs)
scaffold0018 (12-115)||(72867-72971)
[»] scaffold0954 (1 HSPs)
scaffold0954 (1-115)||(3564-3679)
[»] scaffold0254 (1 HSPs)
scaffold0254 (1-78)||(4177-4258)
[»] scaffold0167 (1 HSPs)
scaffold0167 (5-95)||(23623-23714)
[»] scaffold0194 (1 HSPs)
scaffold0194 (28-118)||(24696-24786)
[»] scaffold0036 (1 HSPs)
scaffold0036 (16-70)||(35062-35116)
[»] scaffold0867 (1 HSPs)
scaffold0867 (5-65)||(3719-3778)
[»] scaffold0050 (1 HSPs)
scaffold0050 (45-115)||(58630-58699)


Alignment Details
Target: chr5 (Bit Score: 151; Significance: 6e-80; HSPs: 71)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 118 - 272
Target Start/End: Complemental strand, 1162452 - 1162298
Alignment:
Q  118 tatacaatcctgtctcaaagccttagggatgcagattttgcagcaaaactggctggtttatacaactcttgcaatcaaacatggctagttttacttcttt 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1162452 tatacaatcctgtctcaaagccttagggatgcagattttgcagcaaaactggctggtttatacaactcttgcaatcaaacatggctagttttacttcttt 1162353  T
Q  218 tcacttggaattagtagactagagtggcaccaaactgtgtattaatgtgtgatat 272  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  1162352 tcacttggaattagtagactaaagtggcaccaaactgtgtattaatgtgtgatat 1162298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 3 - 181
Target Start/End: Original strand, 1850662 - 1850840
Alignment:
Q  3 ggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcac 102  Q
    ||||| ||||||||||||||||| ||  ||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||| |||||||||||||    
T  1850662 ggaaataacctcttgtgtaaaaacagaataagggtgcgtacaatacatcaaatggtgggaccacttcctggaccctgcggatgcggaagctttagtgcac 1850761  T
Q  103 cgggttgcccttttttatacaatcctgtctcaaagccttagggatgcagattttgcagcaaaactggctggtttataca 181  Q
    ||| || || || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1850762 cggattaccgttctttatacaatcctgtctcaaagccttagggatgcagattttgcagcaaaactggctggtttataca 1850840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 24448910 - 24449028
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| ||| |||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||    
T  24448910 ctggaaacagccttttgtgtaaaaaatagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtg 24449009  T
Q  100 caccgggttgccctttttt 118  Q
    |||||||||||||||||||    
T  24449010 caccgggttgccctttttt 24449028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 41014339 - 41014454
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |||||| ||  ||||||||||||||||||    
T  41014339 ctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcctggaccccgcatatgcgggagctttagtgc 41014438  T
Q  101 accgggttgccctttt 116  Q
    ||||||||||||||||    
T  41014439 accgggttgccctttt 41014454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 32703444 - 32703558
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| ||||||    
T  32703444 ctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgc 32703542  T
Q  101 accgggttgccctttt 116  Q
    ||||||||||||||||    
T  32703543 accgggttgccctttt 32703558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 19143057 - 19142940
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||||||||||||||||||| ||||||||| |||||||| ||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||    
T  19143057 ctggaaacaacctcttgtgtaaaaacagggtaaggctgcgtacagtacaccaaatggtgggaccccttcccggaccatgcgtatgcgggagatttagtgc 19142958  T
Q  101 accgggttgccctttttt 118  Q
    || ||  |||||||||||    
T  19142957 actggcctgccctttttt 19142940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 130 - 248
Target Start/End: Original strand, 39880615 - 39880729
Alignment:
Q  130 tctcaaagccttagggatgcagattttgcagcaaaactggctggtttatacaactcttgcaatcaaacatggctagttttacttcttttcacttggaatt 229  Q
    ||||||||||||||||||| ||||||||||||||||||||    ||||||||||||||||| |||||||||||||||||  ||||| |||||||||||||    
T  39880615 tctcaaagccttagggatgtagattttgcagcaaaactgg----tttatacaactcttgcattcaaacatggctagtttcgcttctcttcacttggaatt 39880710  T
Q  230 agtagactagagtggcacc 248  Q
    |||||||||||||||||||    
T  39880711 agtagactagagtggcacc 39880729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 130 - 248
Target Start/End: Original strand, 40412704 - 40412818
Alignment:
Q  130 tctcaaagccttagggatgcagattttgcagcaaaactggctggtttatacaactcttgcaatcaaacatggctagttttacttcttttcacttggaatt 229  Q
    ||||||||||||||||||| ||||||||||||||||||||    ||||||||||||||||| |||||||||||||||||  ||||| |||||||||||||    
T  40412704 tctcaaagccttagggatgtagattttgcagcaaaactgg----tttatacaactcttgcattcaaacatggctagtttcgcttctcttcacttggaatt 40412799  T
Q  230 agtagactagagtggcacc 248  Q
    |||||||||||||||||||    
T  40412800 agtagactagagtggcacc 40412818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 38879601 - 38879719
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||| ||||||  ||||||||| |||||||||||||||||  |||||||||||||||||||||||||||| |||||||||||||||    
T  38879601 ctggaaacagcctcttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttag 38879700  T
Q  98 tgcaccgggttgccctttt 116  Q
    |||||||||||||||||||    
T  38879701 tgcaccgggttgccctttt 38879719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 35710333 - 35710449
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| |||||||||||||| |||||||||| ||||| |||||||||||||||||||||||||||||||| | |||  ||||||||||| ||||||    
T  35710333 ctggaaacagcctcttgtgtaaaa-tagggtaaggctgcgttcaatacaccaaatggtgggaccccttcccggaacatgcatatgcgggagctctagtgc 35710431  T
Q  101 accgggttgccctttttt 118  Q
    ||||||||||||||||||    
T  35710432 accgggttgccctttttt 35710449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 8170097 - 8169982
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||| ||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||||||| || |||||    
T  8170097 ctggaaacagccttttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagtttcagtgc 8169999  T
Q  101 accgggttgcccttttt 117  Q
    |||||||||||||||||    
T  8169998 accgggttgcccttttt 8169982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 5 - 103
Target Start/End: Complemental strand, 7097870 - 7097772
Alignment:
Q  5 aaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    ||||| ||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||| |||||||| |||||||||||||||||||||    
T  7097870 aaacagcctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaatggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcacc 7097772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 43334222 - 43334341
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaata--gggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagcttta 96  Q
    ||||||||| |||| |||||||||| |  |||||||| ||||||||||||||||||  ||||||||||||||||||||||||||| ||||||||||||||    
T  43334222 ctggaaacagcctcctgtgtaaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcg-atgcgggagcttta 43334320  T
Q  97 gtgcaccgggttgcccttttt 117  Q
    |||||||||||||||||||||    
T  43334321 gtgcaccgggttgcccttttt 43334341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 43574626 - 43574732
Alignment:
Q  1 ctggaaacaacctcttgtgta-aaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||| |||||||||| |||| ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |    
T  43574626 ctggaaacaatctcttgtgtagaaaacagggtaaggctgcgtacaatataccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagag 43574725  T
Q  100 caccggg 106  Q
    |||||||    
T  43574726 caccggg 43574732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 40 - 116
Target Start/End: Original strand, 16957374 - 16957450
Alignment:
Q  40 gtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  16957374 gtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt 16957450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 186 - 272
Target Start/End: Original strand, 3300186 - 3300270
Alignment:
Q  186 ttgcaatcaaacatggctagttttacttcttttcacttggaattagtagactagagtggcaccaaactgtgtattaatgtgtgatat 272  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||    
T  3300186 ttgcactcaaacatggctagttttacttcttttcacttggaattagtagactagagtggcaccaaac--tgtattaatgtgtgatat 3300270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 186 - 272
Target Start/End: Original strand, 3393079 - 3393163
Alignment:
Q  186 ttgcaatcaaacatggctagttttacttcttttcacttggaattagtagactagagtggcaccaaactgtgtattaatgtgtgatat 272  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||    
T  3393079 ttgcactcaaacatggctagttttacttcttttcacttggaattagtagactagagtggcaccaaac--tgtattaatgtgtgatat 3393163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 7368418 - 7368528
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||  ||| ||||||| ||||||    
T  7368418 ctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaattggtgggaccccttcccggaccctgcatatgtgggagctctagtgc 7368516  T
Q  101 accgggttgccc 112  Q
    ||||||||||||    
T  7368517 accgggttgccc 7368528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 6 - 115
Target Start/End: Complemental strand, 16880757 - 16880647
Alignment:
Q  6 aacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccg 104  Q
    |||| |||||||||||||||  ||||||||| ||||||||||||||||||||||| |||| ||||||||||| |||| ||||||||||||||||||||||    
T  16880757 aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccg 16880658  T
Q  105 ggttgcccttt 115  Q
    |||| ||||||    
T  16880657 ggtttcccttt 16880647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 27 - 115
Target Start/End: Complemental strand, 34154902 - 34154814
Alignment:
Q  27 agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  |||||| |||| |||||||||||||||||||||    
T  34154902 agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgcccttt 34154814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 4619221 - 4619103
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||| | |||||||||||||||  ||||||||| |||||||||||||||||  |||||||||||||||||||||||| ||  ||||| |||||||||    
T  4619221 ctggaaatagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttag 4619122  T
Q  98 tgcaccgggttgccctttt 116  Q
    |||||||||||||||||||    
T  4619121 tgcaccgggttgccctttt 4619103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 13801884 - 13801767
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    |||||| || |||||||||||||||  ||||||||| |||||||||||||||||  |||||||||||||||||||||||| ||  ||||| |||||||||    
T  13801884 ctggaagcagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttag 13801785  T
Q  98 tgcaccgggttgcccttt 115  Q
    ||||||||||||||||||    
T  13801784 tgcaccgggttgcccttt 13801767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 2 - 115
Target Start/End: Complemental strand, 5873435 - 5873322
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||||||| ||||||||||||||||||||||||| |  ||||| |||||||| ||||||||| ||| ||||||| ||||| |||||||||||||||||||    
T  5873435 tggaaacagcctcttgtgtaaaaatagggtaaggctaagtacactacaccaattggtgggactcctccccggacactgcgtatgcgggagctttagtgca 5873336  T
Q  102 ccgggttgcccttt 115  Q
     |||| ||||||||    
T  5873335 tcgggatgcccttt 5873322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 12006445 - 12006329
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    |||||||||||||||| |||||||| |||||||||| | | |||||||||||||  |||||||||||||||||| ||||||||  |||||||||||||||    
T  12006445 ctggaaacaacctcttatgtaaaaaatagggtaaggctccatacaatacaccaataatggtgggaccccttcccagaccctgcctatgcgggagctttag 12006346  T
Q  98 tgcaccgggttgccctt 114  Q
    ||||||| |||||||||    
T  12006345 tgcaccgtgttgccctt 12006329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 20135624 - 20135740
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||||||||||  | ||||||| |||||||||||||||||  |||||||||||||||||||||||| ||  |||| ||||||| ||    
T  20135624 ctggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttcag 20135723  T
Q  98 tgcaccgggttgccctt 114  Q
    |||||||||||||||||    
T  20135724 tgcaccgggttgccctt 20135740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 29334415 - 29334532
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacacca-aatggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||| |||||||||||||||  | ||||||| |||||||||||||||| ||||||||||||| ||||||||||||||| ||| |||| ||||| |    
T  29334415 ctggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccagaatggtgggacccattcccggaccctgcgtatgtgggatctttaat 29334514  T
Q  99 gcaccgggttgccctttt 116  Q
    |||||||| |||||||||    
T  29334515 gcaccgggctgccctttt 29334532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 4 - 92
Target Start/End: Original strand, 2838802 - 2838890
Alignment:
Q  4 gaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagc 92  Q
    |||||| | ||||||||||||| ||||||||| |||||||||||||||||||||||||| |||||| ||||||||||| ||||||||||    
T  2838802 gaaacagcatcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggatcccttctcggaccctgcgtatgcgggagc 2838890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 1405207 - 1405326
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||||||||| | |||||| ||| |||||  ||||||||||||||||||||||||||||| |||| | |||||||  ||||||||||| ||||     
T  1405207 ctggaaacaacctcttatataaaaaatagagtaagtttgcgtacaatacaccaaatggtgggaccctttcctgaaccctgcatatgcgggagctctagta 1405306  T
Q  100 caccgggttgccctttttta 119  Q
    |||||| |||||||||||||    
T  1405307 caccggattgccctttttta 1405326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 27328772 - 27328890
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    |||||||||  ||||||||||||||  ||||||||| |||||||||||||||||  ||||||||||||||||||| |||||||| ||||||||||||||     
T  27328772 ctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccgaaccctgcgtatgcgggagctttaa 27328871  T
Q  98 tgcaccgggttgccctttt 116  Q
    |||| ||| ||||| ||||    
T  27328872 tgcatcggattgccttttt 27328890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 209042 - 208936
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||| |||||||||||||||||||| ||||||||| ||| | |||||||||||| |||||||||||||||| |||||||| | ||||  |||||||||||    
T  209042 ctggcaacaacctcttgtgtaaaaacagggtaaggctgcattcaatacaccaaaatggtgggaccccttcctggaccctgggtatgcaagagctttagtg 208943  T
Q  100 caccggg 106  Q
    |||||||    
T  208942 caccggg 208936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 21 - 116
Target Start/End: Original strand, 3771380 - 3771475
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    ||||| ||||||||| || | |||||||||||| ||||||||||||||||||||| ||| | ||| |||||||||||||||||||| |||||||||    
T  3771380 aaaaacagggtaaggctgtgaacaatacaccaattggtgggaccccttcccggactctgtgtatgtgggagctttagtgcaccgggctgccctttt 3771475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 12575777 - 12575660
Alignment:
Q  1 ctggaaacaacctcttgtgtaaa--aatagggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| ||||||| |||||  || ||| ||| | |||||||||||||||||| |||||||||||||||| |||||||||| |||| |||||||| |    
T  12575777 ctggaaacagcctcttgcgtaaataaacaggctaaagttgcgtacaatacaccaaaatggtgggaccccttcctggaccctgcgtatgcaggagctttgg 12575678  T
Q  98 tgcaccgggttgcccttt 115  Q
    ||||||||| ||||||||    
T  12575677 tgcaccgggctgcccttt 12575660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 53 - 115
Target Start/End: Original strand, 25622533 - 25622595
Alignment:
Q  53 aatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||    
T  25622533 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt 25622595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 1565451 - 1565566
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaataggg--taagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||||||||||| ||||||| |     ||||| |||||||||| |||||||||| ||||||||||||||||||||||  ||| |||||| |||||    
T  1565451 ctggaaacaacctcttgagtaaaaaaacatattaaggctgcgtacaatgcaccaaatggcgggaccccttcccggaccctgcatatgtgggagc-ttagt 1565549  T
Q  99 gcaccgggttgcccttt 115  Q
    |||||||||||||||||    
T  1565550 gcaccgggttgcccttt 1565566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 2 - 116
Target Start/End: Complemental strand, 28516548 - 28516432
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||| |||||||||||||||  ||| || || ||||||||||||| |||| ||||||||||| ||||| ||||||||| |||| ||||||||||||    
T  28516548 tggaaacatcctcttgtgtaaaaaacaggctagggctgcgtacaatacatcaaaatggtgggacccattcccagaccctgcgcatgcaggagctttagtg 28516449  T
Q  100 caccgggttgccctttt 116  Q
     ||| ||||||||||||    
T  28516448 gaccaggttgccctttt 28516432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 170 - 272
Target Start/End: Original strand, 40419663 - 40419760
Alignment:
Q  170 ctggtttatacaactcttgcaatcaaacatggctagttttacttcttttcacttggaattagtagactagagtggcaccaaactgtgtattaatgtgtga 269  Q
    |||||||||| |||||||||| ||||| |||||||||||||||||||||||||| |||||||||| |||||||||  ||||||  ||||||||| |||||    
T  40419663 ctggtttatataactcttgcactcaaatatggctagttttacttcttttcacttagaattagtag-ctagagtgg--ccaaac--tgtattaatctgtga 40419757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 22600474 - 22600569
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagcttt 95  Q
    ||||||||||  | |||||||||| | ||||||||| || ||||||||||||||||||||||| ||||||||||| |||||| |||||||||||||    
T  22600474 ctggaaacaatattttgtgtaaaacacagggtaaggctgtgtacaatacaccaaatggtgggatcccttcccggatcctgcgtatgcgggagcttt 22600569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 5 - 111
Target Start/End: Original strand, 30006349 - 30006456
Alignment:
Q  5 aaacaacctcttgtgtaaa-aatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    |||||||||||| | |||| || ||||||||| || ||||| ||||| ||||||||||||||||||||||  |||  | |||||||||||||||||||||    
T  30006349 aaacaacctcttatataaacaacagggtaaggctgtgtacattacactaaatggtgggaccccttcccggggcctatgtatgcgggagctttagtgcacc 30006448  T
Q  104 gggttgcc 111  Q
    ||||||||    
T  30006449 gggttgcc 30006456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 30 - 123
Target Start/End: Complemental strand, 11657785 - 11657691
Alignment:
Q  30 gtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttttataca 123  Q
    |||||| ||| |||||||||||||| |||||||||||||||||| |||||||  | |||||| ||||||| ||||||| ||||||||||||||||    
T  11657785 gtaaggctgcatacaatacaccaaaatggtgggaccccttcccgaaccctgcacacgcgggaactttagttcaccgggctgcccttttttataca 11657691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 56 - 118
Target Start/End: Complemental strand, 16028683 - 16028621
Alignment:
Q  56 ggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||||||||||||||||||||  ||||||||||| ||||||||||||||||||||||||    
T  16028683 ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt 16028621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 24323820 - 24323725
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagcttt 95  Q
    |||||||||||||||||||||||| | ||||||||  |||||| ||||| |||||| ||||||||||||||| |||||||   |||||||||||||    
T  24323820 ctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatagtgggaccccttcccagaccctgtatatgcgggagcttt 24323725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 24360444 - 24360349
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagcttt 95  Q
    |||||||||||||||||||||||| | ||||||||  |||||| ||||| |||||| ||||||||||||||| |||||||   |||||||||||||    
T  24360444 ctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatagtgggaccccttcccagaccctgtatatgcgggagcttt 24360349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 41425968 - 41426055
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcg 87  Q
    ||||||||||| | |||||||||||  ||||||||| ||| ||||||||||||| ||||||||||||||||| ||| |||||||||||    
T  41425968 ctggaaacaacttattgtgtaaaaaacagggtaaggctgcatacaatacaccaattggtgggaccccttcccagactctgcggatgcg 41426055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 6 - 106
Target Start/End: Original strand, 39301148 - 39301249
Alignment:
Q  6 aacaacctcttgtgta-aaaatagggtaagggtgcgtacaatacaccaaat-ggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    |||||||||||||||| |||| ||||||||| |||||| ||| |||||||  ||||||||||||||||||||||| || ||| ||||| |||||||||||    
T  39301148 aacaacctcttgtgtataaaacagggtaaggatgcgtataatgcaccaaaaaggtgggaccccttcccggaccctccgtatgtgggag-tttagtgcacc 39301246  T
Q  104 ggg 106  Q
    |||    
T  39301247 ggg 39301249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 45 - 118
Target Start/End: Complemental strand, 10943914 - 10943842
Alignment:
Q  45 atacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||||||   ||||||||||||||||||||||  |||||||||||||||||||||||| |||||||||||    
T  10943914 atacaccaaataacgggaccccttcccggaccctgca-atgcgggagctttagtgcaccgggctgccctttttt 10943842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 37 - 106
Target Start/End: Original strand, 13774922 - 13774991
Alignment:
Q  37 tgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccggg 106  Q
    |||| ||||||||||||||||  ||| ||||| |||||||||||| ||||||||||||||||||||||||    
T  13774922 tgcgcacaatacaccaaatggcaggatccctttccggaccctgcgtatgcgggagctttagtgcaccggg 13774991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 55 - 116
Target Start/End: Original strand, 39801591 - 39801652
Alignment:
Q  55 tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    ||||||||||||||||| |||||| || ||||||||||||||||||||||||||||| ||||    
T  39801591 tggtgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgccatttt 39801652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 52 - 112
Target Start/End: Complemental strand, 21784395 - 21784335
Alignment:
Q  52 aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccc 112  Q
    ||||||||||||||||| |||||||||||| ||||||||| |||||||||||| |||||||    
T  21784395 aaatggtgggacccctttccggaccctgcgtatgcgggaggtttagtgcaccgagttgccc 21784335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 64 - 116
Target Start/End: Original strand, 32354211 - 32354263
Alignment:
Q  64 cccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    |||||||||||||||| | ||||||||||||||||||||||||||||||||||    
T  32354211 cccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccctttt 32354263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 7 - 118
Target Start/End: Complemental strand, 37226070 - 37225958
Alignment:
Q  7 acaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgg 105  Q
    ||||| |||||| ||||||| |||||||  || |||||||||| |||| |||||||||||||||||| ||| |||| ||||  ||| |||||||||| ||    
T  37226070 acaacatcttgtataaaaattgggtaagaatgtgtacaatacaacaaaatggtgggaccccttcccgaaccatgcgtatgccagaggtttagtgcactgg 37225971  T
Q  106 gttgccctttttt 118  Q
     ||||||||||||    
T  37225970 attgccctttttt 37225958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 42 - 96
Target Start/End: Complemental strand, 10306548 - 10306493
Alignment:
Q  42 acaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagcttta 96  Q
    ||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||    
T  10306548 acaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagcttta 10306493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 4 - 67
Target Start/End: Complemental strand, 22907976 - 22907913
Alignment:
Q  4 gaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggacccct 67  Q
    |||||| ||||||||||||||| || |||||| ||| |||||||||||||||||||||||||||    
T  22907976 gaaacagcctcttgtgtaaaaacagagtaaggttgcatacaatacaccaaatggtgggacccct 22907913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 56 - 115
Target Start/End: Complemental strand, 30877623 - 30877564
Alignment:
Q  56 ggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    |||||||||||||||||||||||||  ||| ||||||| |||||||||||||||||||||    
T  30877623 ggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcccttt 30877564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 116
Target Start/End: Complemental strand, 22861742 - 22861668
Alignment:
Q  42 acaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    |||||||| ||||||||||||||||||| || |||||||  ||||||||||| ||||||||||  ||||||||||    
T  22861742 acaatacatcaaatggtgggaccccttctcgaaccctgcatatgcgggagctctagtgcaccgaattgccctttt 22861668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 31 - 103
Target Start/End: Complemental strand, 12477205 - 12477132
Alignment:
Q  31 taagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    ||||| |||||||||||||||||| ||||||||||||||||||||  ||||| ||||  |||||||||||||||    
T  12477205 taaggctgcgtacaatacaccaaaatggtgggaccccttcccggattctgcgtatgcaagagctttagtgcacc 12477132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 5 - 117
Target Start/End: Complemental strand, 24903807 - 24903694
Alignment:
Q  5 aaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    ||||| ||| ||||||||||| |||||||||  || ||||||| |||||| ||||| ||||||||||||||| ||||  | |||||| |||| |||||||    
T  24903807 aaacagccttttgtgtaaaaaatagggtaagattgtgtacaatccaccaattggtgagaccccttcccggacactgcatacgcgggaactttggtgcacc 24903708  T
Q  104 gggttgcccttttt 117  Q
    ||| || |||||||    
T  24903707 gggctgtccttttt 24903694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 5 - 115
Target Start/End: Complemental strand, 42924945 - 42924830
Alignment:
Q  5 aaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggac--cctgcggatgcgggagctttagtg 99  Q
    ||||||| |||||||||||||  ||||||||| ||||||||||||||||||  || ||| | |||||||| |||  |||||| |||||| ||||||||||    
T  42924945 aaacaacatcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaaaatgatggaatcccttcccagacaccctgcgtatgcggaagctttagtg 42924846  T
Q  100 caccgggttgcccttt 115  Q
    |||||| ||| |||||    
T  42924845 caccggattgtccttt 42924830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 52 - 118
Target Start/End: Original strand, 19093885 - 19093951
Alignment:
Q  52 aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||  ||||||| ||||||||||||| |||  ||||||||||||||||||| |||||||||||    
T  19093885 aaatggtatgacccctacccggaccctgcgtatgttggagctttagtgcaccgggctgccctttttt 19093951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 40 - 111
Target Start/End: Complemental strand, 39079827 - 39079755
Alignment:
Q  40 gtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcc 111  Q
    ||||||||||||||| |||||||||||||||||||||| || | || |||||| |||||||||| ||| ||||    
T  39079827 gtacaatacaccaaaatggtgggaccccttcccggaccatgtgtatacgggagttttagtgcacagggctgcc 39079755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 50 - 93
Target Start/End: Complemental strand, 21542532 - 21542489
Alignment:
Q  50 ccaaatggtgggaccccttcccggaccctgcggatgcgggagct 93  Q
    |||||||||||||||||||||||||| ||||| |||||||||||    
T  21542532 ccaaatggtgggaccccttcccggactctgcgtatgcgggagct 21542489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 116
Target Start/End: Complemental strand, 24313658 - 24313571
Alignment:
Q  31 taagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccc-tgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    ||||| ||||| |||||||||||| |||||||||||||||||||  || || | |||| | ||||||||||||||||| |||||||||    
T  24313658 taaggttgcgttcaatacaccaaaatggtgggaccccttcccggcgccatgtgtatgctgtagctttagtgcaccgggctgccctttt 24313571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 31 - 116
Target Start/End: Complemental strand, 24355995 - 24355908
Alignment:
Q  31 taagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccc-tgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    ||||| ||||| |||||||||||| |||||||||||||||||||  || || | |||| | ||||||||||||||||| |||||||||    
T  24355995 taaggttgcgttcaatacaccaaaatggtgggaccccttcccggcgccatgtgtatgctgtagctttagtgcaccgggctgccctttt 24355908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 102
Target Start/End: Complemental strand, 3176839 - 3176770
Alignment:
Q  30 gtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcac 102  Q
    |||||| ||||||||||||||||| |||||||||||   ||||||| ||| | |||| |||||||||||||||    
T  3176839 gtaaggttgcgtacaatacaccaactggtgggaccc---cccggactctgtgtatgccggagctttagtgcac 3176770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 103
Target Start/End: Complemental strand, 31694202 - 31694120
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    ||||||||| ||| | ||| ||||||||||| | || |||||| ||||||| |||| |||| ||||||||| |||||||||||    
T  31694202 aaaaataggctaaagctgcatacaatacacctattgatgggactccttcccagaccttgcgtatgcgggagatttagtgcacc 31694120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 5 - 101
Target Start/End: Original strand, 18426063 - 18426160
Alignment:
Q  5 aaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||||| |||||||||||||| ||| | |||| || |||||||||| | ||||||| ||||||||  || || ||||| ||||| |||||||||||||    
T  18426063 aaacaatctcttgtgtaaaaaatagagaaaggttgtgtacaatacatcgaatggtgagaccccttttcgaactctgcgtatgcgagagctttagtgca 18426160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 73 - 114
Target Start/End: Complemental strand, 29184103 - 29184062
Alignment:
Q  73 gaccctgcggatgcgggagctttagtgcaccgggttgccctt 114  Q
    |||| |||| ||||||||||||||||||||||||||||||||    
T  29184103 gaccatgcgtatgcgggagctttagtgcaccgggttgccctt 29184062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 74 - 118
Target Start/End: Original strand, 18099955 - 18099999
Alignment:
Q  74 accctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||| |||||||||||||||||||| ||||| |||||||||    
T  18099955 accctgcgtatgcgggagctttagtgcactgggtttccctttttt 18099999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 4 - 106
Target Start/End: Complemental strand, 34074674 - 34074573
Alignment:
Q  4 gaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcac 102  Q
    |||||| |||||||||||||||  |  |||||| ||||| |||||||||||||||  || |||||||||  |||||||| ||| ||||||  ||||||||    
T  34074674 gaaacagcctcttgtgtaaaaaacacagtaaggttgcgttcaatacaccaaatggcagggccccttcccaaaccctgcgtatgggggagc--tagtgcac 34074577  T
Q  103 cggg 106  Q
    ||||    
T  34074576 cggg 34074573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 52 - 103
Target Start/End: Complemental strand, 4654478 - 4654427
Alignment:
Q  52 aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    ||||||||||| |||||| || |||||||  |||||||||||||||||||||    
T  4654478 aaatggtgggatcccttctcgaaccctgcatatgcgggagctttagtgcacc 4654427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 22 - 105
Target Start/End: Complemental strand, 9794471 - 9794388
Alignment:
Q  22 aaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgg 105  Q
    |||| ||||||||  ||| ||||||||||||||| |||||| |||||| | ||||| ||  |||| | ||||||||||||||||    
T  9794471 aaaacagggtaagactgcatacaatacaccaaatagtgggatcccttcacagacccagcatatgcagaagctttagtgcaccgg 9794388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 68 - 110
Target Start/End: Original strand, 18684361 - 18684403
Alignment:
Q  68 tcccggaccctgcggatgcgggagctttagtgcaccgggttgc 110  Q
    |||| ||||||||| ||||||||||||||||||| ||||||||    
T  18684361 tcccagaccctgcgtatgcgggagctttagtgcatcgggttgc 18684403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 103; Significance: 3e-51; HSPs: 4)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 46851 - 46969
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  46851 ctggaaacaacctcttgtgtaaaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg 46950  T
Q  100 caccgggttgccctttttt 118  Q
    |||||||||||||||||||    
T  46951 caccgggttgccctttttt 46969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 6 - 118
Target Start/End: Complemental strand, 24882 - 24769
Alignment:
Q  6 aacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccg 104  Q
    |||| |||||||||||||||  ||||||||| ||||||||| |||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |     
T  24882 aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaacacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcagcc 24783  T
Q  105 ggttgccctttttt 118  Q
    ||||||||||||||    
T  24782 ggttgccctttttt 24769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #3
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 43679 - 43794
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggacccc-ttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| | ||||||||||||  ||| ||||| |||||||||||||||||||||||||||||| ||| ||||||||||  ||||||||||| |||||    
T  43679 ctggaaacagcgtcttgtgtaaaacaagg-taaggctgcgtacaatacaccaaatggtgggacccctttctcggaccctgcatatgcgggagctctagtg 43777  T
Q  100 caccgggttgccctttt 116  Q
    ||| | |||||||||||    
T  43778 cactgagttgccctttt 43794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 27 - 119
Target Start/End: Complemental strand, 46796 - 46703
Alignment:
Q  27 agggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttta 119  Q
    ||||||||| ||| ||||||| |||||| ||||||||||||||||| ||||||||| |||||||||||||| |||| | || ||||| ||||||    
T  46796 agggtaaggatgcatacaatataccaaaatggtgggaccccttcccagaccctgcgtatgcgggagctttaatgcatcaggctgcccattttta 46703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 83)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 40272927 - 40272807
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||||||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  40272927 ctggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg 40272828  T
Q  100 caccgggttgcccttttttat 120  Q
    |||||||||||||||||||||    
T  40272827 caccgggttgcccttttttat 40272807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 2 - 114
Target Start/End: Original strand, 22609809 - 22609921
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| ||||||    
T  22609809 tggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgca 22609908  T
Q  102 ccgggttgccctt 114  Q
    |||||||||||||    
T  22609909 ccgggttgccctt 22609921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 54484732 - 54484850
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatag--ggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||| ||||||||||||||| |   ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  54484732 ctggaaacagcctcttgtgtaaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagt 54484831  T
Q  99 gcaccgggttgcccttttt 117  Q
    |||||||||||||||||||    
T  54484832 gcaccgggttgcccttttt 54484850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 26869749 - 26869866
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||| ||||||||| ||||||||| |||||||||||||||||||||||||||||||| ||||||| |||| ||||||||||||| ||||    
T  26869749 ctggaaacagcctctggtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttgccggaccatgcgtatgcgggagctttggtgc 26869848  T
Q  101 accgggttgccctttttt 118  Q
    ||||||||||||||||||    
T  26869849 accgggttgccctttttt 26869866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 13628907 - 13628789
Alignment:
Q  1 ctggaaacaacctcttgtgtaa-aaatagggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||||||| ||| ||||||||| |||||||||||||||||  |||||||||||||||||||||||||||| |||||||||||||||    
T  13628907 ctggaaacagcctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttag 13628808  T
Q  98 tgcaccgggttgccctttt 116  Q
    |||||||||||||||||||    
T  13628807 tgcaccgggttgccctttt 13628789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 1217132 - 1217247
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||||||||| ||||||||||||||||||||| ||||||||||||||||||||||  ||||||||||| ||||||    
T  1217132 ctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggcgggaccccttcccggaccctgcatatgcgggagctctagtgc 1217230  T
Q  101 accgggttgcccttttt 117  Q
    |||||||||||||||||    
T  1217231 accgggttgcccttttt 1217247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 4 - 115
Target Start/End: Original strand, 39203561 - 39203671
Alignment:
Q  4 gaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    |||||| ||||||||||||||  ||||||||| |||||||||||||||||||||||||||||||||||||||| |||  |||||||||||||||||||||    
T  39203561 gaaacagcctcttgtgtaaaac-agggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccttgcatatgcgggagctttagtgcacc 39203659  T
Q  104 gggttgcccttt 115  Q
    ||||||||||||    
T  39203660 gggttgcccttt 39203671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 31592891 - 31593004
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||||||||| ||||||||||||||||||||||||||| ||||||||||||||||  ||||||||||| ||||||    
T  31592891 ctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggactccttcccggaccctgcatatgcgggagctctagtgc 31592989  T
Q  101 accgggttgcccttt 115  Q
    |||||||||||||||    
T  31592990 accgggttgcccttt 31593004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 11 - 120
Target Start/End: Original strand, 15797274 - 15797382
Alignment:
Q  11 cctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgc 110  Q
    ||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||| ||||||| ||||||||||||||||    
T  15797274 cctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgc 15797372  T
Q  111 ccttttttat 120  Q
    ||||||||||    
T  15797373 ccttttttat 15797382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 45948953 - 45948848
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||||||||||||||||||| |||||||||| ||| ||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||||||    
T  45948953 ctggaaacaacctcttgtgtaaaaaatagggtaaggctgcatacaatacaccaattggtgggaccccttctcggaccctgcgtatgcgggagctttagtg 45948854  T
Q  100 caccgg 105  Q
    ||||||    
T  45948853 caccgg 45948848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 2 - 123
Target Start/End: Complemental strand, 54374460 - 54374337
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||||||||||||||||| |||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||  ||||||||||||||||     
T  54374460 tggaaacaacctcttgtgtaaaaaatagggtaaggctgcgtacaatccaccaaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtt 54374361  T
Q  100 caccgggttgcccttttttataca 123  Q
    |||| || |||| |||||||||||    
T  54374360 caccaggctgccattttttataca 54374337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 5 - 115
Target Start/End: Complemental strand, 45786327 - 45786214
Alignment:
Q  5 aaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    ||||| |||||||||||||||  ||||||||| ||||||||||||||||||  ||||||||||||||||||||||||||| |||| ||||||||||||||    
T  45786327 aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgca 45786228  T
Q  102 ccgggttgcccttt 115  Q
    ||||||||||||||    
T  45786227 ccgggttgcccttt 45786214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 46421152 - 46421031
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagcttt-a 96  Q
    ||||||||| |||||||||||||||  ||||||||| |||||||||||||||||  |||||||||||||||||||||||||||| ||||||||||||| |    
T  46421152 ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttaa 46421053  T
Q  97 gtgcaccgggttgccctttttt 118  Q
    ||||||||| ||||||||||||    
T  46421052 gtgcaccggtttgccctttttt 46421031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 13730719 - 13730599
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||||||||||  ||||||||| || ||||||||||||||  |||||||||||||||||||||||| ||  |||||||||||||||    
T  13730719 ctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttag 13730620  T
Q  98 tgcaccgggttgccctttttt 118  Q
    |||||||||||||||||||||    
T  13730619 tgcaccgggttgccctttttt 13730599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 22123030 - 22122918
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    |||||||||  |||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||| ||||| ||||||    
T  22123030 ctggaaacagtctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgagagctctagtgc 22122932  T
Q  101 accgggttgccctt 114  Q
    ||||||||||||||    
T  22122931 accgggttgccctt 22122918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 2 - 119
Target Start/End: Complemental strand, 49013589 - 49013469
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    |||||||| |||||||||||||||  ||||||||| |||||||||||||||||  |||||||||||||||||||||||| ||  | ||||||||||||||    
T  49013589 tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagt 49013490  T
Q  99 gcaccgggttgccctttttta 119  Q
    |||||||||||||||||||||    
T  49013489 gcaccgggttgccctttttta 49013469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 4 - 116
Target Start/End: Original strand, 16735486 - 16735598
Alignment:
Q  4 gaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    |||||| ||||||||  ||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||||| |||||||     
T  16735486 gaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcact 16735585  T
Q  104 gggttgccctttt 116  Q
    |||||||||||||    
T  16735586 gggttgccctttt 16735598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 30 - 118
Target Start/End: Complemental strand, 52926304 - 52926216
Alignment:
Q  30 gtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||| ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||    
T  52926304 gtaaggctgcgtacaatacaccaaatggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctttttt 52926216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 5173835 - 5173717
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||||||||||||||||||| |  |||||| ||| | ||||||||||||  ||||||| |||||||||||||| |||| ||||||||||||||||    
T  5173835 ctggaaacaacctcttgtgtaaaaacaaagtaaggttgcatgcaatacaccaaaaatggtggggccccttcccggaccttgcgtatgcgggagctttagt 5173736  T
Q  99 gcaccgggttgcccttttt 117  Q
    |||||||||||||||||||    
T  5173735 gcaccgggttgcccttttt 5173717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 5 - 104
Target Start/End: Complemental strand, 6411932 - 6411833
Alignment:
Q  5 aaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccg 104  Q
    ||||| ||||||||||||||| ||||||||| |||||||||||||||||||| |||||||||||||| |||| |||| ||||||||||||||||||||||    
T  6411932 aaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcaccg 6411833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 29366837 - 29366719
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||| ||||||  ||||||||| |||||||||||||||||  |||||||||||||||||||||||||||| ||| |||||||||||    
T  29366837 ctggaaacagcctcttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgtgggagctttag 29366738  T
Q  98 tgcaccgggttgccctttt 116  Q
    ||||| |||||||||||||    
T  29366737 tgcactgggttgccctttt 29366719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 22 - 117
Target Start/End: Complemental strand, 34771457 - 34771362
Alignment:
Q  22 aaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttt 117  Q
    |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| |||||||||||| ||||||||||    
T  34771457 aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgcccttttt 34771362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 10795540 - 10795423
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||||||||| | ||||||||| ||||||||||||||||||  |||||||||||||||| |||||||||| |||||||||||| ||    
T  10795540 ctggaaacagcctcttgtgtaaaagacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcag 10795441  T
Q  98 tgcaccgggttgcccttt 115  Q
    |||||| |||||||||||    
T  10795440 tgcaccaggttgcccttt 10795423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 2 - 117
Target Start/End: Complemental strand, 53996680 - 53996563
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||||||||||||||||||  ||||||||| ||| |||||||||||||| ||||||||||||||||| ||| ||||| ||| |||||||||||||    
T  53996680 tggaaacaacctcttgtgtaaaaaacagggtaaggctgcttacaatacaccaaaatggtgggaccccttccctgacactgcgtatgtgggagctttagtg 53996581  T
Q  100 caccgggttgcccttttt 117  Q
    ||||||| ||||||||||    
T  53996580 caccgggctgcccttttt 53996563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 12914150 - 12914034
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| |||||||||||||||  |||||||||  |||||||||||||||||||||| ||||||||||| ||||||||  |||||||||||| | ||    
T  12914150 ctggaaacagcctcttgtgtaaaaaacagggtaaggcggcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgcgggagcttcaatg 12914051  T
Q  100 caccgggttgccctttt 116  Q
    |||||||||||||||||    
T  12914050 caccgggttgccctttt 12914034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 516451 - 516571
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa---tggtgggaccccttcccggaccctgcggatgcgggagcttta 96  Q
    ||||||||| |||||||||||||||  ||||||||| |||| |||||| ||||||   ||| ||||||||||||| ||||||||| ||||||||||||||    
T  516451 ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgcacaataaaccaaaaaatggcgggaccccttccccgaccctgcgtatgcgggagcttta 516550  T
Q  97 gtgcaccgggttgcccttttt 117  Q
    |||||||||||||||||||||    
T  516551 gtgcaccgggttgcccttttt 516571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 8247804 - 8247683
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagcttt-a 96  Q
    ||||||||| |||||||||||||||  ||||||||| |||||||||||||||||  |||||||||| ||||||||||||||||| ||||||||||||| |    
T  8247804 ctggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggactccttcccggaccctgcgtatgcgggagctttaa 8247705  T
Q  97 gtgcaccgggttgccctttttt 118  Q
    |||||| |||||||||| ||||    
T  8247704 gtgcactgggttgccctatttt 8247683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 14986999 - 14987116
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||||||||||  ||||||||| |||||||||||||||||  |||||||||||| |||||||||| |||  |||||||||||||||    
T  14986999 ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcgggagctttag 14987098  T
Q  98 tgcaccgggttgcccttt 115  Q
    ||||||||||| ||||||    
T  14987099 tgcaccgggtttcccttt 14987116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 25517286 - 25517169
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatag--ggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||| ||||||||||||||| |   | || || |||||||||||||| ||||||||||||||||||||||| |||||| |||| |||||||||||    
T  25517286 ctggaaacatcctcttgtgtaaaaaaacaagatatggctgcgtacaatacacaaaatggtgggaccccttcccggatcctgcgtatgctggagctttagt 25517187  T
Q  99 gcaccgggttgccctttt 116  Q
    ||||||||||||||||||    
T  25517186 gcaccgggttgccctttt 25517169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 26573169 - 26573287
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| |||| ||||||||||  ||||||||| ||||||||||||||||| |||||||||||| |||||||||||||| ||||| |||||||||||    
T  26573169 ctggaaacagcctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaattggtgggaccccatcccggaccctgcgtatgcgtgagctttagtg 26573268  T
Q  100 caccgggttgccctttttt 118  Q
    |||| || |||||| ||||    
T  26573269 caccaggctgccctctttt 26573287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 21 - 113
Target Start/End: Complemental strand, 353445 - 353351
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccct 113  Q
    ||||| ||||||||| |||||||||||||||||  |||||||||||||||||||||||| ||  |||||||||||||||||||||||||||||||    
T  353445 aaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct 353351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 34420759 - 34420641
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||| |||||||||||||||  ||||||||| ||||||| |||||||||| |||||||||||||||||||||| |||| ||| ||||||||||||    
T  34420759 ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtaccatacaccaaaatggtgggaccccttcccggaccttgcgtatgtgggagctttagt 34420660  T
Q  99 gcaccgggttgcccttttt 117  Q
    ||||  || ||||||||||    
T  34420659 gcacatggctgcccttttt 34420641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 5 - 79
Target Start/End: Original strand, 47624088 - 47624162
Alignment:
Q  5 aaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctg 79  Q
    ||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  47624088 aaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg 47624162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 49 - 118
Target Start/End: Complemental strand, 24851367 - 24851298
Alignment:
Q  49 accaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||||||||||||||||||||| |||||  ||||||||||||||||||||||||||||||||||||    
T  24851367 accaaatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgccctttttt 24851298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 4 - 120
Target Start/End: Complemental strand, 50625065 - 50624948
Alignment:
Q  4 gaaacaacctcttgtgta-aaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcac 102  Q
    |||||| ||||||||||| |||| |||||||||  |||||||||||||||  ||||||||| |||||| || ||||||| | | ||||||||||||||||    
T  50625065 gaaacagcctcttgtgtataaaaaagggtaaggtagcgtacaatacaccatttggtgggacgccttcctgggccctgcgtaagtgggagctttagtgcac 50624966  T
Q  103 cgggttgcccttttttat 120  Q
    |||| |||||||||||||    
T  50624965 cgggctgcccttttttat 50624948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 33926125 - 33926224
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacacca-aatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||| | ||||||||||||||| ||||||||| || ||||||||||||| |||||||||||||||||| |||||||||  ||||| |||||||||||    
T  33926125 ctggaaatagcctcttgtgtaaaaacagggtaaggctgtgtacaatacaccataatggtgggaccccttcctggaccctgcatatgcgagagctttagtg 33926224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 7943032 - 7943150
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| | |||||| ||||||  ||||||||  ||||||||||||| |||||||||||| ||||| || |||| |||| |||||||||||||||||    
T  7943032 ctggaaacagcatcttgtctaaaaaacagggtaagactgcgtacaatacatcaaatggtgggatccctttccagaccatgcgtatgcgggagctttagtg 7943131  T
Q  100 caccgggttgccctttttt 118  Q
    ||| |||||||| ||||||    
T  7943132 cactgggttgccttttttt 7943150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 4 - 119
Target Start/End: Complemental strand, 829555 - 829438
Alignment:
Q  4 gaaacaacctcttgtgtaaa-aatagggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    ||||||||||||||| |||| || |  |||| | |||||||||||||||||| |||||||||||||||||| |||||||| |||| ||||||||||||||    
T  829555 gaaacaacctcttgtctaaagaacatagtaaagttgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgca 829456  T
Q  102 ccgggttgccctttttta 119  Q
    ||||  || |||||||||    
T  829455 ccggtctgtcctttttta 829438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 11 - 115
Target Start/End: Original strand, 9276316 - 9276419
Alignment:
Q  11 cctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttg 109  Q
    |||||||||||||||  ||||||||| |||||||||||||||||||||| |||||| ||||||||||||||| |||||||| ||||| ||| | ||||||    
T  9276316 cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggt-ggaccctttcccggaccctgcgtatgcgggaacttta-tgcgcagggttg 9276413  T
Q  110 cccttt 115  Q
    ||||||    
T  9276414 cccttt 9276419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 2 - 114
Target Start/End: Complemental strand, 45139592 - 45139479
Alignment:
Q  2 tggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacacc--aaatggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||||||||||||||||| | ||||||||| ||| |||||||||||  |||||||||||||||||||| || |||||| |||||||| |||| ||    
T  45139592 tggaaacaacctcttgtgtaaaacacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccaga-cctgcgtatgcgggaacttt-gt 45139495  T
Q  99 gcaccgggttgccctt 114  Q
    |||||||| |||||||    
T  45139494 gcaccgggctgccctt 45139479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 55 - 121
Target Start/End: Original strand, 30452892 - 30452958
Alignment:
Q  55 tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttttata 121  Q
    ||||||||||||||||||||||||||  ||||||||||| |||||||||||||||||||||| ||||    
T  30452892 tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttatata 30452958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 60 - 116
Target Start/End: Complemental strand, 10484671 - 10484615
Alignment:
Q  60 ggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||    
T  10484671 ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt 10484615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 19731044 - 19731155
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||| | |||||||||||||||  | ||||||| ||||||||||||||| | ||||||||||| ||||| ||| ||| | |||| ||||||||||||    
T  19731044 ctggaaatagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacacctattggtgggaccctttcccagactctgtgtatgcaggagctttagtg 19731143  T
Q  100 caccgggttgcc 111  Q
    ||||||| ||||    
T  19731144 caccgggctgcc 19731155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 40 - 118
Target Start/End: Original strand, 25944551 - 25944630
Alignment:
Q  40 gtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||||||||||||| ||||||||||||||||| ||||||||| ||| ||||||||||| ||||| || |||||||||||    
T  25944551 gtacaatacaccaaaatggtgggaccccttccctgaccctgcgtatgtgggagctttagcgcaccaggctgccctttttt 25944630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 67 - 118
Target Start/End: Original strand, 47624208 - 47624259
Alignment:
Q  67 ttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  47624208 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt 47624259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 54032674 - 54032570
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||||||||||||||||||  ||||||||| ||| ||||||||||| |||||||||            |||||||| |||||||||||||||||    
T  54032674 ctggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccgaatggtggg------------accctgcgtatgcgggagctttagtg 54032587  T
Q  100 caccgggttgccctttt 116  Q
    |||||||||||||||||    
T  54032586 caccgggttgccctttt 54032570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 11 - 117
Target Start/End: Original strand, 26292384 - 26292489
Alignment:
Q  11 cctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgc 110  Q
    ||||||||||||||  ||||||||   |||||| |||||||||||| ||||| ||||||||| |||||||  |||||||| || |||||||||||||||     
T  26292384 cctcttgtgtaaaac-agggtaagaccgcgtacgatacaccaaatgatgggatcccttcccgaaccctgcatatgcgggaactctagtgcaccgggttgt 26292482  T
Q  111 ccttttt 117  Q
    |||||||    
T  26292483 ccttttt 26292489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 21 - 119
Target Start/End: Complemental strand, 4495758 - 4495672
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttta 119  Q
    ||||| ||||||||| |||||||||||||||||||||||||||||            |||| |||||||||||||||||||||||||||||||||||||    
T  4495758 aaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccc------------tgcgtatgcgggagctttagtgcaccgggttgccctttttta 4495672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 7697000 - 7696893
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    |||||||||  |||||||||||||  ||||||||| |||||||||||||||||||||     ||||||||||||| ||||  ||| ||||||| ||||||    
T  7697000 ctggaaacagtctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatgg-----ccccttcccggacactgcatatgtgggagctctagtgc 7696907  T
Q  101 accgggttgccctt 114  Q
    |||||||| |||||    
T  7696906 accgggtttccctt 7696893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 43114985 - 43114882
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaata--gggtaaggg-tgcgtacaatacaccaaatggtgggaccccttcccgga-ccctgcggatgcgggagcttta 96  Q
    ||||||||| ||||||||||||||| |  ||||||||| | | |||||||||||||||||||||| ||||||| ||| ||||||| ||||||||||||||    
T  43114985 ctggaaacagcctcttgtgtaaaaaaacagggtaagggctacctacaatacaccaaatggtggga-cccttcctggacccctgcgtatgcgggagcttta 43114887  T
Q  97 gtgca 101  Q
    |||||    
T  43114886 gtgca 43114882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 11 - 117
Target Start/End: Complemental strand, 44403661 - 44403553
Alignment:
Q  11 cctcttgtgtaaaa-atagggtaagggtgcgtacaatac-accaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggtt 108  Q
    |||||||||||||| | | ||||||| |||| | ||||| || ||||||||||||||||||||||||||| || |||| | ||||||||||||||||| |    
T  44403661 cctcttgtgtaaaagacaaggtaaggctgcggagaataccacaaaatggtgggaccccttcccggaccctacgtatgctgaagctttagtgcaccgggct 44403562  T
Q  109 gcccttttt 117  Q
    ||| |||||    
T  44403561 gcctttttt 44403553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 19751620 - 19751731
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||| | |||||||||||||||| | ||||||| ||||||||||||||| | ||||||||||| ||||| |||  || | ||||  |||||||||||    
T  19751620 ctggaaatagcctcttgtgtaaaaatcaaggtaaggttgcgtacaatacacctattggtgggaccctttcccagactttgtgtatgcatgagctttagtg 19751719  T
Q  100 caccgggttgcc 111  Q
    ||||||| ||||    
T  19751720 caccgggctgcc 19751731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 40 - 119
Target Start/End: Original strand, 24577917 - 24577996
Alignment:
Q  40 gtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttta 119  Q
    ||||||||||| ||||||||||| || ||||| ||||||||  || |||||||| ||||||||||| |||||||||||||    
T  24577917 gtacaatacactaaatggtgggatcctttcccagaccctgcatatacgggagctctagtgcaccggattgccctttttta 24577996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 40 - 119
Target Start/End: Original strand, 24578007 - 24578086
Alignment:
Q  40 gtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttta 119  Q
    ||||||||||| |||||||||||| | ||||| |||||| |  |||||||| || |||||||||||||||||||||||||    
T  24578007 gtacaatacactaaatggtgggactctttcccagaccctacatatgcgggaactctagtgcaccgggttgccctttttta 24578086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 30928262 - 30928167
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagcttt 95  Q
    ||||||||| |||||||||||||||  | ||||||| || ||| |||||||||| ||| ||||||||||||||||||||||  ||| |||||||||    
T  30928262 ctggaaacagcctcttgtgtaaaaaacaaggtaaggttgtgtaaaatacaccaattggcgggaccccttcccggaccctgcatatgtgggagcttt 30928167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 9607245 - 9607345
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| ||||||| |||||||  ||||||||| |||||| ||||||||||  ||| |||||||||||||| ||||| ||  |||||||||||||||    
T  9607245 ctggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtagaatacaccaataatgttgggaccccttcccagaccccgcatatgcgggagctttag 9607344  T
Q  98 t 98  Q
    |    
T  9607345 t 9607345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 50 - 119
Target Start/End: Original strand, 35417996 - 35418065
Alignment:
Q  50 ccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttta 119  Q
    |||||||||||||||||||||||||||| ||  ||||| ||||||||||||| |||| ||||| ||||||    
T  35417996 ccaaatggtgggaccccttcccggaccccgcaaatgcgagagctttagtgcatcgggctgcccattttta 35418065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 31831241 - 31831343
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| |||||||||||||| |||||||||| ||| ||||||||||||||||||           |||||||||||  ||||||| ||| ||||||    
T  31831241 ctggaaacagcctcttgtgtaaaa-tagggtaaggctgcatacaatacaccaaatggt-----------ccggaccctgcatatgcgggtgctctagtgc 31831328  T
Q  101 accgggttgcccttt 115  Q
    |||||||||||||||    
T  31831329 accgggttgcccttt 31831343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 74 - 118
Target Start/End: Original strand, 40390357 - 40390401
Alignment:
Q  74 accctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||| ||||||||||||||||||||||||||||||||||||    
T  40390357 accctgcgtatgcgggagctttagtgcaccgggttgccctttttt 40390401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 5 - 111
Target Start/End: Original strand, 55401222 - 55401330
Alignment:
Q  5 aaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcac 102  Q
    ||||| |||||||||||||||  ||| ||||  |||||| ||||||||||| ||||||||||||||| |||||| | || |||||||||||||  |||||    
T  55401222 aaacagcctcttgtgtaaaaaacaggttaagactgcgtataatacaccaaaatggtgggaccccttctcggaccttccgtatgcgggagcttttttgcac 55401321  T
Q  103 cgggttgcc 111  Q
    |||| ||||    
T  55401322 cgggctgcc 55401330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 31904972 - 31904857
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtggga-ccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||| ||| || ||||||||  |||||| |  |||||||||||||||||||||||||| ||||||||| || | | ||  |||||||||||||||    
T  31904972 ctggaaacagcctattatgtaaaaaacagggtatgactgcgtacaatacaccaaatggtgggacccccttcccagatcttacgtgtgcgggagctttagt 31904873  T
Q  99 gcaccgggttgccctt 114  Q
    ||||| || |||||||    
T  31904872 gcaccaggctgccctt 31904857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 52428592 - 52428479
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaatggtgg-------gaccccttcccggaccctgcggatgcgggagc 92  Q
    |||||| || |||||||||||||| | ||||||||| ||||||||||||||||||| ||||        |||||||| |||||||| || ||| ||||||    
T  52428592 ctggaagcagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatagtggaaccccaaaccccttctcggaccctacgtatgtgggagc 52428493  T
Q  93 tttagtgcaccggg 106  Q
    ||||||||||||||    
T  52428492 tttagtgcaccggg 52428479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 11 - 114
Target Start/End: Original strand, 33235583 - 33235687
Alignment:
Q  11 cctcttgtgtaaaaata--gggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggtt 108  Q
    ||||||||||||||| |  |||||||  || ||||||||||| ||||||||||||||| || | |||| | || |||||| |||||||||||||| ||||    
T  33235583 cctcttgtgtaaaaaaacagggtaagactgtgtacaatacactaaatggtgggacccc-tcgcagaccttacgtatgcggaagctttagtgcaccaggtt 33235681  T
Q  109 gccctt 114  Q
    ||||||    
T  33235682 gccctt 33235687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 55 - 115
Target Start/End: Complemental strand, 14266431 - 14266372
Alignment:
Q  55 tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||||||||| |||| | |||||||| |||||||||||||||||||| ||||||||||||    
T  14266431 tggtgggaccc-ttcctgaaccctgcgtatgcgggagctttagtgcactgggttgcccttt 14266372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 5 - 68
Target Start/End: Original strand, 29106595 - 29106659
Alignment:
Q  5 aaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaaatggtgggacccctt 68  Q
    ||||||||||||||||||||| |||| ||||| | ||||||||||||||||| |||||| |||||    
T  29106595 aaacaacctcttgtgtaaaaaataggataaggttacgtacaatacaccaaattgtgggatccctt 29106659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 45620944 - 45620881
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaata--gggtaagggtgcgtacaatacaccaaatggtggga 62  Q
    ||||||||| ||||||||||||||| |  |||||||| ||||||||||||||||| ||||||||    
T  45620944 ctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaattggtggga 45620881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 12525449 - 12525567
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| |||||||||||||||| ||||||||| |||| |  | ||   |||||||||||| ||||||  ||||||| | || ||||||||| | ||    
T  12525449 ctggaaacagcctcttgtgtaaaaatcagggtaaggctgcgaagtacaccaaaaatggtgggacaccttcctagaccctgtgtatacgggagcttcactg 12525548  T
Q  100 caccgggttgccctttttt 118  Q
    |||| |||||| |||||||    
T  12525549 caccaggttgctctttttt 12525567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 118
Target Start/End: Complemental strand, 43956515 - 43956469
Alignment:
Q  72 ggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||| ||| |||||||||||||||||||||||| |||||||||||    
T  43956515 ggacccagcgtatgcgggagctttagtgcaccgggctgccctttttt 43956469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 69 - 118
Target Start/End: Complemental strand, 6242331 - 6242282
Alignment:
Q  69 cccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||||||||||  |||| |||||| ||||||||||||||||||||||||    
T  6242331 cccggaccctgcatatgcaggagctctagtgcaccgggttgccctttttt 6242282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 21875055 - 21875111
Alignment:
Q  1 ctggaaacaacctcttgtgt--aaaaatagggtaagggtgcgtacaatacaccaaat 55  Q
    ||||||||||||||||||||  ||||| ||||||||| |||||||||||||| ||||    
T  21875055 ctggaaacaacctcttgtgttaaaaaagagggtaaggctgcgtacaatacactaaat 21875111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 44 - 101
Target Start/End: Complemental strand, 46170038 - 46169981
Alignment:
Q  44 aatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||| |||||||||| |||||||||||||||||||||  ||| |||||||| ||||||    
T  46170038 aataaaccaaatggtaggaccccttcccggaccctgcatatgtgggagcttcagtgca 46169981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 61 - 118
Target Start/End: Original strand, 51644074 - 51644131
Alignment:
Q  61 gaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||||| |||||||| | ||||| |||||||||||||||| | |||||||||||    
T  51644074 gaccccttcctggaccctgggtatgcgagagctttagtgcaccgcggtgccctttttt 51644131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 76 - 115
Target Start/End: Original strand, 23871484 - 23871523
Alignment:
Q  76 cctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    |||||| |||||||| ||||||||||||||||||||||||    
T  23871484 cctgcgtatgcgggaactttagtgcaccgggttgcccttt 23871523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 40 - 115
Target Start/End: Original strand, 28905026 - 28905100
Alignment:
Q  40 gtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||| ||||||||||  |||||||| ||||||||||||||| | |||||| |||||||| | |||| ||||||||    
T  28905026 gtacattacaccaaata-tgggaccctttcccggaccctgcgtaagcgggaactttagtgtaacgggctgcccttt 28905100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 59 - 114
Target Start/End: Complemental strand, 45288111 - 45288056
Alignment:
Q  59 gggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctt 114  Q
    |||||| |||||||||||||||| ||||  ||||||||||||||| || |||||||    
T  45288111 gggacctcttcccggaccctgcgtatgcaagagctttagtgcaccaggctgccctt 45288056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 118
Target Start/End: Complemental strand, 10696272 - 10696210
Alignment:
Q  56 ggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||||||||||| |||||||||  | ||||||| |||||||||  || |||||||||||    
T  10696272 ggtgggaccccttcccagaccctgcgtctacgggagcattagtgcactaggctgccctttttt 10696210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 118
Target Start/End: Original strand, 19325184 - 19325238
Alignment:
Q  64 cccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||||||||||| || | |||||| | ||||||||||||||| |||||||||||    
T  19325184 cccttcccggaccgtgtgaatgcggaatctttagtgcaccgggctgccctttttt 19325238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 116
Target Start/End: Complemental strand, 45416986 - 45416933
Alignment:
Q  62 accccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    |||||||||||||||||||| |||| | |||||| |||||||||| |||||||||    
T  45416986 accccttcccggaccctgcgtatgcagaagcttt-gtgcaccgggctgccctttt 45416933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 10870066 - 10870025
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgta 42  Q
    ||||||||| ||||||||||||||| ||||||||| ||||||    
T  10870066 ctggaaacagcctcttgtgtaaaaacagggtaaggctgcgta 10870025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 115
Target Start/End: Original strand, 4835835 - 4835899
Alignment:
Q  51 caaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    |||||| ||| ||| ||| |||||||||||| || || |||||| |||||||||||||| |||||    
T  4835835 caaatgatggaaccgctttccggaccctgcgtatacgtgagcttcagtgcaccgggttgtccttt 4835899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 50 - 118
Target Start/End: Original strand, 10300583 - 10300651
Alignment:
Q  50 ccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||||| |||||| ||||||| |||||| || |||||||||||||| || || || ||||| ||||||    
T  10300583 ccaaatgatgggactccttcccagaccctacgtatgcgggagctttaatgtactggattgccttttttt 10300651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 96
Target Start/End: Original strand, 19349808 - 19349888
Alignment:
Q  16 tgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagcttta 96  Q
    |||||||||||||| ||| | ||| |||||||||  |||||||||||||| ||  || |||||||| ||  ||||||||||    
T  19349808 tgtgtaaaaataggataaagttgcatacaatacattaaatggtgggaccctttttcgaaccctgcgtatatgggagcttta 19349888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 52 - 116
Target Start/End: Original strand, 40968612 - 40968676
Alignment:
Q  52 aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    |||||||| ||||||||||  |||||| |  ||||||||||||||||||| || | |||||||||    
T  40968612 aaatggtgagaccccttcctagaccctacatatgcgggagctttagtgcatcgagctgccctttt 40968676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 90)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 5648279 - 5648395
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||    
T  5648279 ctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgc 5648378  T
Q  101 accgggttgcccttttt 117  Q
    || ||||||||||||||    
T  5648379 actgggttgcccttttt 5648395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 2 - 114
Target Start/End: Complemental strand, 6430739 - 6430627
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |||    
T  6430739 tggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccacttcccggaccctgcgtatgcgggagctttagcgca 6430640  T
Q  102 ccgggttgccctt 114  Q
    |||||||||||||    
T  6430639 ccgggttgccctt 6430627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 20639774 - 20639655
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||| |||||||||||||||  ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||    
T  20639774 ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagt 20639675  T
Q  99 gcaccgggttgccctttttt 118  Q
    ||||||||||||||||||||    
T  20639674 gcaccgggttgccctttttt 20639655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 20225004 - 20225117
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||||||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| ||||||    
T  20225004 ctggaaacaacctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgc 20225102  T
Q  101 accgggttgcccttt 115  Q
    |||||||||||||||    
T  20225103 accgggttgcccttt 20225117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 30639400 - 30639517
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    |||||||||  |||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||  ||||||||||||||||||    
T  30639400 ctggaaacagactcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgagaccccttcccggaccctgcatatgcgggagctttagtgc 30639499  T
Q  101 accgggttgccctttttt 118  Q
    || |||||||||||||||    
T  30639500 actgggttgccctttttt 30639517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 25629069 - 25629186
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||  ||||||||||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||| |  |||||||||||||||||    
T  25629069 ctggaaacagtctcttgtgtaaaaaatagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctacatatgcgggagctttagtg 25629168  T
Q  100 caccgggttgcccttttt 117  Q
    ||||||||||||||||||    
T  25629169 caccgggttgcccttttt 25629186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 40915849 - 40915962
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||| | ||||||| |||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |||||    
T  40915849 ctggaaacagcctcttgtgtaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgc 40915948  T
Q  101 accgggttgccctt 114  Q
    ||||| ||||||||    
T  40915949 accggattgccctt 40915962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 5306778 - 5306657
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatg----cgggagcttta 96  Q
    ||||||||| ||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||    |||||||||||    
T  5306778 ctggaaacagcctcttgtgtaaaatcagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgtggacgggagcttta 5306679  T
Q  97 gtgcaccgggttgccctttttt 118  Q
     |||||||||||||||||||||    
T  5306678 atgcaccgggttgccctttttt 5306657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 7909395 - 7909281
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgc-gggagctttagtg 99  Q
    |||||||||  |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |||| |||||||||||||    
T  7909395 ctggaaacagtctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcggggagctttagtg 7909296  T
Q  100 caccgggttgccctt 114  Q
    || ||||||||||||    
T  7909295 catcgggttgccctt 7909281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 47528643 - 47528527
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||||||||| |||||||||||||||||||||||||||||||||||||||||||   ||| ||||||| ||||||    
T  47528643 ctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgaatatgtgggagctctagtgc 47528545  T
Q  101 accgggttgccctttttt 118  Q
    ||||||||||||||||||    
T  47528544 accgggttgccctttttt 47528527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 48598938 - 48598823
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||||||||| |||||||||||||||||||||||||||||||||||||||| |||  |||| |||||| ||||||    
T  48598938 ctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccatgcatatgccggagctctagtgc 48598840  T
Q  101 accgggttgcccttttt 117  Q
    |||||||||||||||||    
T  48598839 accgggttgcccttttt 48598823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 11 - 118
Target Start/End: Original strand, 23501817 - 23501927
Alignment:
Q  11 cctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggt 107  Q
    |||||||||||||||  ||||||||| |||||||||||||||||  |||||||||||||||||||||||||||  |||||||||||||||||||||||||    
T  23501817 cctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggt 23501916  T
Q  108 tgccctttttt 118  Q
    |||||||||||    
T  23501917 tgccctttttt 23501927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 11 - 113
Target Start/End: Complemental strand, 29208001 - 29207900
Alignment:
Q  11 cctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgc 110  Q
    ||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| ||||||||||||||||    
T  29208001 cctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgc 29207903  T
Q  111 cct 113  Q
    |||    
T  29207902 cct 29207900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 47443977 - 47444095
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| ||||||| |||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  |||| ||||||| ||||    
T  47443977 ctggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcaggagcttcagtg 47444076  T
Q  100 caccgggttgccctttttt 118  Q
    ||| |||||||||||||||    
T  47444077 cactgggttgccctttttt 47444095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 5 - 117
Target Start/End: Original strand, 54175088 - 54175202
Alignment:
Q  5 aaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacacc-aaatggtgggacccctt-cccggaccctgcggatgcgggagctttagtgcac 102  Q
    ||||| ||||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||| ||||||||||||  ||||||||||||||||||||    
T  54175088 aaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttccccggaccctgcatatgcgggagctttagtgcac 54175187  T
Q  103 cgggttgcccttttt 117  Q
    |||| ||||||||||    
T  54175188 cgggctgcccttttt 54175202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 4 - 116
Target Start/End: Original strand, 14983857 - 14983970
Alignment:
Q  4 gaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcac 102  Q
    |||||| |||||||||||||| ||||||||||| ||| |||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||    
T  14983857 gaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtac 14983956  T
Q  103 cgggttgccctttt 116  Q
    |  |||||||||||    
T  14983957 catgttgccctttt 14983970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 5 - 117
Target Start/End: Complemental strand, 9832422 - 9832311
Alignment:
Q  5 aaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccg 104  Q
    ||||| ||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  |||| ||| || ||||||||||    
T  9832422 aaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcaggaactctagtgcaccg 9832324  T
Q  105 ggttgcccttttt 117  Q
    |||||||||||||    
T  9832323 ggttgcccttttt 9832311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 9987949 - 9987831
Alignment:
Q  1 ctggaaacaacctcttgtgtaaa-aatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||||||||||||||||| |||||||||||| ||| ||||||||||||||||||||||||||||||  |||| |||  |||||||||||||| ||    
T  9987949 ctggaaacaacctcttgtgtaaacaatagggtaaggctgcatacaatacaccaaatggtgggaccccttccttgaccttgcatatgcgggagctttaatg 9987850  T
Q  100 caccgggttgccctttttt 118  Q
    ||||||| |||| ||||||    
T  9987849 caccgggctgccttttttt 9987831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 2 - 119
Target Start/End: Original strand, 35567191 - 35567309
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    |||||||| || ||||||||||||  ||||||||| || |||||| |||||||||||||||||||||||||| ||||||||  |||||||||||||||||    
T  35567191 tggaaacagccacttgtgtaaaaaacagggtaaggctgtgtacaacacaccaaatggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgc 35567290  T
Q  101 accgggttgccctttttta 119  Q
    |||||| ||||||||||||    
T  35567291 accgggctgccctttttta 35567309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 16408718 - 16408598
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||||||||||  ||||||||  |||||||||||||||||  ||||||| |||||||||||||||| ||  |||||||||||||||    
T  16408718 ctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaataatggtggaaccccttcccggaccccgcatatgcgggagctttag 16408619  T
Q  98 tgcaccgggttgccctttttt 118  Q
    |||||||||||||||||||||    
T  16408618 tgcaccgggttgccctttttt 16408598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 4 - 116
Target Start/End: Original strand, 16911585 - 16911700
Alignment:
Q  4 gaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    |||||| ||||||||||| |||| ||||||||| |||||||||||||||||  |||||||||||||||||||||||||||| | ||||||||||||||      
T  16911585 gaaacagcctcttgtgtacaaatcagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtacgcgggagctttagttt 16911684  T
Q  101 accgggttgccctttt 116  Q
    ||||||||||||||||    
T  16911685 accgggttgccctttt 16911700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 5 - 116
Target Start/End: Complemental strand, 51865149 - 51865037
Alignment:
Q  5 aaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    ||||| |||||||||||||||  | ||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||||    
T  51865149 aaacagcctcttgtgtaaaaaacatggtaaggctgcgtacaatacaccaaatggtggggccccttcccggaccctgcgtatgcgggagctttattgcacc 51865050  T
Q  104 gggttgccctttt 116  Q
    ||  |||||||||    
T  51865049 ggactgccctttt 51865037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 21646984 - 21647098
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| ||||||||||||||| |||||||||| ||||||||||| |||||  |||||||||||||||||| ||||| ||  |||||||||||||||    
T  21646984 ctggaaacagcctcttgtgtaaaaaatagggtaaggctgcgtacaatataccaataatggtgggaccccttcccagaccccgcatatgcgggagctttag 21647083  T
Q  98 tgcaccgggttgccc 112  Q
    |||||||||||||||    
T  21647084 tgcaccgggttgccc 21647098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 12 - 118
Target Start/End: Complemental strand, 11054250 - 11054145
Alignment:
Q  12 ctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcc 111  Q
    |||||||||||||  ||||||||  ||||||||||||||||||||| || |||||||||||||||||||  ||||||||||| |||||||||||||||||    
T  11054250 ctcttgtgtaaaac-agggtaagactgcgtacaatacaccaaatggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcc 11054152  T
Q  112 ctttttt 118  Q
    |||||||    
T  11054151 ctttttt 11054145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 21 - 115
Target Start/End: Complemental strand, 30690270 - 30690176
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||| ||||||||| ||| ||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| || ||||||||    
T  30690270 aaaaacagggtaaggctgcatacaatacaccaattggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgcccttt 30690176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 49796818 - 49796911
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctt 94  Q
    ||||||||| |||||||||| |||| | ||||||| |||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||    
T  49796818 ctggaaacagcctcttgtgttaaaacatggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctt 49796911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 27 - 115
Target Start/End: Original strand, 20225121 - 20225211
Alignment:
Q  27 agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||||||| |||||||||||||||||  |||||||||||||||||||||||| ||  |||||||||||||||||||||||||||||||||    
T  20225121 agggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt 20225211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 17043509 - 17043392
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| |||||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||  |||| ||||||||| ||    
T  17043509 ctggaaacagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccagaccctgcatatgctggagcttta-tg 17043411  T
Q  100 caccgggttgccctttttt 118  Q
    |||| || ||||| |||||    
T  17043410 caccaggctgccccttttt 17043392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 32478900 - 32478792
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||||||||| ||||||||| ||||||||| ||     |||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||    
T  32478900 ctggaaacaacctctagtgtaaaaacagggtaaggctg-----aatacaccaaatggtgggaccccttcccggacccagcgtatgcgggagcttt-gtgc 32478807  T
Q  101 accgggttgcccttt 115  Q
    ||||||| |||||||    
T  32478806 accgggtggcccttt 32478792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 44 - 118
Target Start/End: Original strand, 38786673 - 38786747
Alignment:
Q  44 aatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||||||||||||||||||||||||||||||||  ||||||||||| ||||||||||||||||||||||||    
T  38786673 aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttttt 38786747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 5 - 115
Target Start/End: Complemental strand, 44363243 - 44363130
Alignment:
Q  5 aaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    ||||| |||| ||||||||||  |||||| || |||||||||  |||||||  ||||||||||||||||||||||||||| |||||||||||||||||||    
T  44363243 aaacagcctcgtgtgtaaaaaacagggtagggctgcgtacaacgcaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca 44363144  T
Q  102 ccgggttgcccttt 115  Q
    ||||||||||||||    
T  44363143 ccgggttgcccttt 44363130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 19027868 - 19027973
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||||| |||||||||||||  ||||||||| ||||||||||||||||| |||||||||||||| || ||| ||||| ||| |||||||||||||    
T  19027868 ctggaaacaacatcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaattggtgggacccctttccagactctgcgtatgtgggagctttagtg 19027967  T
Q  100 caccgg 105  Q
    ||||||    
T  19027968 caccgg 19027973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 25463142 - 25463258
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaata-gggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||||||||||||||||||   ||| |||| ||||||||| ||||||||||||||||||||||||||||||||||  ||||||||||||| |||    
T  25463142 ctggaaacaacctcttgtgtaaaaaactgggaaaggttgcgtacaacacaccaaatggtgggaccccttcccggaccctgcatatgcgggagcttt-gtg 25463240  T
Q  100 caccgggttgcccttttt 117  Q
    |||| || | ||||||||    
T  25463241 caccaggctacccttttt 25463258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 37494871 - 37494972
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||||||||||||||||||  ||||||||| ||| ||||||| |||||||||||||||||||| | |||||||||| |||| ||||||||||||    
T  37494871 ctggaaacaacctcttgtgtaaaaaacagggtaaggttgcatacaatataccaaatggtgggacccctttcgggaccctgcgtatgcaggagctttagtg 37494970  T
Q  100 ca 101  Q
    ||    
T  37494971 ca 37494972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 39077909 - 39077793
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||||||||| ||||||||||| ||||||||||| |||  ||| |||||||||||  ||||||||||| ||||||    
T  39077909 ctggaaacagcctcttgtgtaaaac-agggtaaggttgcgtacaatataccaaatggtgagacatctttccggaccctgcatatgcgggagctctagtgc 39077811  T
Q  101 accgggttgccctttttt 118  Q
    ||||||||||| ||||||    
T  39077810 accgggttgccttttttt 39077793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 41018908 - 41018807
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    |||||||||||||||||||||||| |||||||||| | ||||||||||||||||| ||||||||||||||| |||| |||| |||  || ||||||||||    
T  41018908 ctggaaacaacctcttgtgtaaaattagggtaaggctacgtacaatacaccaaatagtgggaccccttcccagaccttgcgtatggaggggctttagtgc 41018809  T
Q  101 ac 102  Q
    ||    
T  41018808 ac 41018807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 37 - 118
Target Start/End: Complemental strand, 30352660 - 30352577
Alignment:
Q  37 tgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||||||||||||||||  ||||||||||||||| ||||||||||| |||||||||||||||||||||| |||||||||||||    
T  30352660 tgcgtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgccctttttt 30352577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 41 - 118
Target Start/End: Complemental strand, 33836563 - 33836484
Alignment:
Q  41 tacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||||||||  |||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||    
T  33836563 tacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgccctttttt 33836484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 8473735 - 8473621
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggacccctt-cccgga-ccctgcggatgcgggagctttagt 98  Q
    ||||||||| ||||||||||  ||  ||||||||| ||| |||||||||||||||||||||||||||| |||||| ||||||  ||||||||||||||||    
T  8473735 ctggaaacagcctcttgtgtttaac-agggtaaggctgcatacaatacaccaaatggtgggaccccttccccggacccctgcatatgcgggagctttagt 8473637  T
Q  99 gcaccgggttgccctt 114  Q
    ||||||||||||||||    
T  8473636 gcaccgggttgccctt 8473621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 11 - 117
Target Start/End: Complemental strand, 13256506 - 13256397
Alignment:
Q  11 cctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggt 107  Q
    |||||||||||||||  ||||||||| |||||||||||||||||  || |||||||||||||||| |||| ||   ||||||||||||||||||||||||    
T  13256506 cctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggt 13256407  T
Q  108 tgcccttttt 117  Q
    ||||||||||    
T  13256406 tgcccttttt 13256397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 29 - 118
Target Start/End: Complemental strand, 20908723 - 20908633
Alignment:
Q  29 ggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||||| |||||||||||||||||| |||||||||||||||||| |||||||| ||||||||||||||||||||  || |||||||||||    
T  20908723 ggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacaaggctgccctttttt 20908633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 53 - 115
Target Start/End: Complemental strand, 38755970 - 38755908
Alignment:
Q  53 aatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  38755970 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 38755908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 2 - 99
Target Start/End: Complemental strand, 30581581 - 30581481
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaata--gggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    |||||||||||||||||||||||| |  ||||||||||| ||||||||||||||| ||||||||||||||||||||||||||  |||  |||||||||||    
T  30581581 tggaaacaacctcttgtgtaaaaaaacagggtaagggtgtgtacaatacaccaaaatggtgggaccccttcccggaccctgcatatgtaggagctttagt 30581482  T
Q  99 g 99  Q
    |    
T  30581481 g 30581481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 4 - 119
Target Start/End: Original strand, 54730272 - 54730391
Alignment:
Q  4 gaaacaacctcttgtgtaaaaa--tagggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||| |||||||||||||||  |||| ||||| |||||| ||||||||||  ||| ||| |||||||||||||||||||| |||||||||||||||||    
T  54730272 gaaacagcctcttgtgtaaaaaaataggataaggctgcgtataatacaccaataatgatggaaccccttcccggaccctgcgtatgcgggagctttagtg 54730371  T
Q  100 caccgggttgccctttttta 119  Q
    |||||  || ||||||||||    
T  54730372 caccgaattaccctttttta 54730391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 51 - 115
Target Start/End: Original strand, 11394923 - 11394987
Alignment:
Q  51 caaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||    
T  11394923 caaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 11394987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 51 - 115
Target Start/End: Original strand, 11404650 - 11404714
Alignment:
Q  51 caaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||    
T  11404650 caaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 11404714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 54 - 118
Target Start/End: Original strand, 32484307 - 32484371
Alignment:
Q  54 atggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||    
T  32484307 atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttttt 32484371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 13 - 115
Target Start/End: Complemental strand, 55766568 - 55766466
Alignment:
Q  13 tcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccc 112  Q
    ||||||||  ||| ||||||||| ||||||||||||||  |||||||| ||||| ||||||||| |||| ||||| |||||||||||||||||| |||||    
T  55766568 tcttgtgtgtaaacagggtaaggctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccgggatgccc 55766469  T
Q  113 ttt 115  Q
    |||    
T  55766468 ttt 55766466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 4 - 117
Target Start/End: Complemental strand, 10277867 - 10277755
Alignment:
Q  4 gaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    |||||| |||||||| ||||| |||| ||||| |||||||||||||||||||||||  |||||||||| ||||||||  ||||||||| | ||||| |||    
T  10277867 gaaacagcctcttgtataaaa-taggataaggctgcgtacaatacaccaaatggtgaaaccccttcccagaccctgcatatgcgggagttctagtgaacc 10277769  T
Q  104 gggttgcccttttt 117  Q
    || |||||||||||    
T  10277768 ggattgcccttttt 10277755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 4 - 115
Target Start/End: Original strand, 20405109 - 20405224
Alignment:
Q  4 gaaacaacctcttgtgtaaaaata--gggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||| ||||||||||||||| |  |||||||  |||||||||||||| ||  |||||||||||||||||||||||| ||  |||||||||||||||||    
T  20405109 gaaacagcctcttgtgtaaaaaaacagggtaagattgcgtacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtg 20405208  T
Q  100 caccgggttgcccttt 115  Q
    ||  ||||||||||||    
T  20405209 cattgggttgcccttt 20405224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 54 - 115
Target Start/End: Complemental strand, 40553998 - 40553937
Alignment:
Q  54 atggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    |||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  40553998 atggtgtgaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 40553937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 7385591 - 7385499
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagc 92  Q
    ||||||||| |||| |||||||||| |||||||||| || || ||||||||||||||||||||||| ||||||||||||| | ||||||||||    
T  7385591 ctggaaacagcctcatgtgtaaaaaatagggtaaggttgtgtgcaatacaccaaatggtgggaccctttcccggaccctgtgtatgcgggagc 7385499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 54967041 - 54967151
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||| |||||||||||||||||  ||||||||| ||| ||||||| |||||||||||||||||||||||| ||||| |  ||||||||||||| |||    
T  54967041 ctggaaagaacctcttgtgtaaaaaacagggtaaggttgc-tacaatataccaaatggtgggaccccttcccgtaccctacatatgcgggagcttt-gtg 54967138  T
Q  100 caccgggttgccc 112  Q
    ||||||| |||||    
T  54967139 caccgggctgccc 54967151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 21489107 - 21489218
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||| ||||||| |||||||  || |||||  |||||||||| ||||||| |||||||||||||||||| |||||||| ||||||||||||| ||    
T  21489107 ctggaaacagcctcttgcgtaaaaaacagagtaagactgcgtacaatgcaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttcgt 21489206  T
Q  99 gcaccgggttgc 110  Q
    |||| |||||||    
T  21489207 gcactgggttgc 21489218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 53 - 115
Target Start/End: Original strand, 25388249 - 25388311
Alignment:
Q  53 aatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||||||||||||||||||||||||||| ||||  |||||||||||||||||||||||||||    
T  25388249 aatggtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttgcccttt 25388311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 37 - 118
Target Start/End: Complemental strand, 36816463 - 36816381
Alignment:
Q  37 tgcgtacaatacaccaaat-ggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||||||||||||||||  |||||||| |||||| |||||||| | ||||||||||||||||| ||||||||||||||||||    
T  36816463 tgcgtacaatacaccaaaaaggtgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgccctttttt 36816381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 65 - 118
Target Start/End: Original strand, 35532077 - 35532130
Alignment:
Q  65 ccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  35532077 ccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt 35532130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 2 - 115
Target Start/End: Complemental strand, 55830834 - 55830721
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    ||||||||  |||||||||  ||| ||||||| | ||||||||||||||  |||||||| ||||| ||||||||| |||| ||||| |||||||||||||    
T  55830834 tggaaacagtctcttgtgtgtaaacagggtaatgctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgca 55830735  T
Q  102 ccgggttgcccttt 115  Q
    || || ||||||||    
T  55830734 ccaggatgcccttt 55830721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 5 - 114
Target Start/End: Complemental strand, 12711561 - 12711450
Alignment:
Q  5 aaacaacctcttgtgtaaaaa--tagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcac 102  Q
    ||||||| |||||||||||||  |||||||||  ||||||||||||||||||||| ||||||||||| | ||||  ||| |||||| | |||||||||||    
T  12711561 aaacaacatcttgtgtaaaaaaatagggtaagactgcgtacaatacaccaaatggcgggaccccttctcagacctagcgtatgcggaaactttagtgcac 12711462  T
Q  103 cgggttgccctt 114  Q
    |  |||||||||    
T  12711461 ccagttgccctt 12711450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 4 - 116
Target Start/End: Original strand, 7038075 - 7038188
Alignment:
Q  4 gaaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||||| | ||||||||||||| |||||||||  | |||||||||||||||| ||||||| | ||| ||||||||||||| || ||| ||||||||||||    
T  7038075 gaaacagcttcttgtgtaaaaaatagggtaagacttcgtacaatacaccaaaatggtggggcacctacccggaccctgcgtatacgg-agctttagtgca 7038173  T
Q  102 ccgggttgccctttt 116  Q
    | |||||||||||||    
T  7038174 ctgggttgccctttt 7038188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 10660424 - 10660544
Alignment:
Q  1 ctggaaacaacctcttgtgt-aaaaatagggtaagggtgcgtacaatacacca--aatggtgggaccccttcccggaccctgcggatgcgggagcttt-a 96  Q
    |||||||||||||||| ||| |||||||||||| || ||| ||||||||||||  ||||||| ||||||||||  || |||||| ||||||||||||| |    
T  10660424 ctggaaacaacctcttatgtaaaaaatagggtatggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagctttaa 10660522  T
Q  97 gtgcaccgggttgccctttttt 118  Q
    ||||| |||||||||| |||||    
T  10660523 gtgcatcgggttgccccttttt 10660544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 10874569 - 10874689
Alignment:
Q  1 ctggaaacaacctcttgtgt-aaaaatagggtaagggtgcgtacaatacacca--aatggtgggaccccttcccggaccctgcggatgcgggagcttt-a 96  Q
    |||||||||||||||| ||| |||||||||||| || ||| ||||||||||||  ||||||| ||||||||||  || |||||| ||||||||||||| |    
T  10874569 ctggaaacaacctcttatgtaaaaaatagggtatggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagctttaa 10874667  T
Q  97 gtgcaccgggttgccctttttt 118  Q
    ||||| |||||||||| |||||    
T  10874668 gtgcatcgggttgccccttttt 10874689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 2 - 104
Target Start/End: Complemental strand, 30496434 - 30496333
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||||||| ||||||||||||| |  |||||||| ||| ||||||||||||||||| ||||| |||||||||||| |||  |||  ||||||||||||||    
T  30496434 tggaaacagcctcttgtgtaaacac-gggtaaggctgcatacaatacaccaaatggggggactccttcccggaccgtgcttatgatggagctttagtgca 30496336  T
Q  102 ccg 104  Q
    |||    
T  30496335 ccg 30496333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 12 - 105
Target Start/End: Complemental strand, 47441634 - 47441540
Alignment:
Q  12 ctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgg 105  Q
    ||||| ||||||||| ||||||||| || ||||||||||||||||||| |||||||||||||||||||| | | || |||||||| || ||||||    
T  47441634 ctcttttgtaaaaatcagggtaaggctgtgtacaatacaccaaatggttggaccccttcccggaccctgagtaagcaggagctttcgtccaccgg 47441540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 2 - 97
Target Start/End: Complemental strand, 39029175 - 39029078
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    |||||||| |||||||||||||||  ||||||||| || ||||||||||| ||| |||||||||| ||| |||||||||||  |||||||||||||||    
T  39029175 tggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacacgaaaatggtgggaccactttccggaccctgcatatgcgggagctttag 39029078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 54 - 115
Target Start/End: Original strand, 44718641 - 44718702
Alignment:
Q  54 atggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    |||||||||||||||||| ||||||||| |||||||||||||||  ||||||||||||||||    
T  44718641 atggtgggaccccttcccagaccctgcgtatgcgggagctttagcacaccgggttgcccttt 44718702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 53 - 118
Target Start/End: Complemental strand, 50555718 - 50555653
Alignment:
Q  53 aatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||| |||||||||||||||||||| |||| |||| |||||||||||||| |||||||||||    
T  50555718 aatggtggaaccccttcccggaccctgcgtatgcaggagttttagtgcaccgggctgccctttttt 50555653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 52 - 116
Target Start/End: Complemental strand, 47482913 - 47482849
Alignment:
Q  52 aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    |||||||||||||||||||||||||||||| ||||||||||||| ||||| || | |||||||||    
T  47482913 aaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcaacgagctgccctttt 47482849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 49938705 - 49938611
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||||||||||  ||||||||    ||||||||||||||| |||||||||||||||||  |||||||  |||||||||||||||    
T  49938705 ctggaaacagcctcttgtgtaaaaacggggtaaggt---gtacaatacaccaaaatggtgggaccccttcccataccctgcatatgcgggagctttag 49938611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 55 - 120
Target Start/End: Original strand, 19027986 - 19028051
Alignment:
Q  55 tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttttat 120  Q
    ||||||||| |||||||||||||  |  |||||||||||||||||||||||| |||||||||||||    
T  19027986 tggtgggactccttcccggaccccacttatgcgggagctttagtgcaccgggctgcccttttttat 19028051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 9 - 95
Target Start/End: Complemental strand, 3580947 - 3580860
Alignment:
Q  9 aacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagcttt 95  Q
    |||||||||||||||||  | ||||||| || || |||||||||||||| | |||||||||||||||||||||  ||| |||||||||    
T  3580947 aacctcttgtgtaaaaaccatggtaaggctgtgtgcaatacaccaaatgctaggaccccttcccggaccctgcatatgtgggagcttt 3580860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 51 - 118
Target Start/End: Original strand, 28494222 - 28494289
Alignment:
Q  51 caaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||||||||||||||||||| || |||||  ||||||||||| |||||||||||| |||| ||||||    
T  28494222 caaatggtgggaccccttcccagatcctgcatatgcgggagctctagtgcaccgggctgccttttttt 28494289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 2 - 106
Target Start/End: Complemental strand, 487249 - 487135
Alignment:
Q  2 tggaaacaacctcttgtgta-aaaatagggtaagggtgcgtacaatacaccaaa---------tggtgggaccccttcccggaccctgcggatgcgggag 91  Q
    |||||||||||||||||||| |||| | ||||| | |||||||||||||| |||         ||| ||||||||||||||||  ||||| |||||||||    
T  487249 tggaaacaacctcttgtgtataaaacaaggtaaagctgcgtacaatacactaaaatggtgggatggcgggaccccttcccggattctgcgaatgcgggag 487150  T
Q  92 ctttagtgcaccggg 106  Q
    |||||||||||||||    
T  487149 ctttagtgcaccggg 487135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 64 - 117
Target Start/End: Original strand, 56322984 - 56323037
Alignment:
Q  64 cccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttt 117  Q
    |||||||||||||| |   |||||||||||||||||||||||||||||||||||    
T  56322984 cccttcccggaccccggatatgcgggagctttagtgcaccgggttgcccttttt 56323037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 27 - 115
Target Start/End: Original strand, 2813172 - 2813263
Alignment:
Q  27 agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagcttt-agtgcaccgggttgcccttt 115  Q
    ||||||||  ||||||||||||| |||  |||||||||||| |||||| ||  |||| ||||||||||||| |||||||||| |||||||||    
T  2813172 agggtaagactgcgtacaatacatcaataatggtgggaccctttcccgaacgatgcgtatgcgggagctttaagtgcaccggattgcccttt 2813263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 5 - 61
Target Start/End: Complemental strand, 10380053 - 10379997
Alignment:
Q  5 aaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtggg 61  Q
    ||||||||||||||||||||||||| |||   ||||||||||||||||||| |||||    
T  10380053 aaacaacctcttgtgtaaaaataggataaaattgcgtacaatacaccaaatagtggg 10379997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 22 - 106
Target Start/End: Original strand, 16494259 - 16494345
Alignment:
Q  22 aaaatagggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccggg 106  Q
    |||| ||||||| | ||| ||||||||||||||  ||||||||||| ||||| ||||||| | |||||| |||||||||| ||||||    
T  16494259 aaaacagggtaaagctgcatacaatacaccaaaaatggtgggaccctttcccagaccctgtgtatgcggaagctttagtgtaccggg 16494345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 12 - 115
Target Start/End: Complemental strand, 48327869 - 48327763
Alignment:
Q  12 ctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggtt 108  Q
    ||||||||||||||  ||||||||  ||| |||||||||||||  ||||||||||| ||||||| ||||  |  |||||| || ||||||||||||||||    
T  48327869 ctcttgtgtaaaaaacagggtaagactgcatacaatacaccaataatggtgggacctcttcccgaaccccacatatgcggaagttttagtgcaccgggtt 48327770  T
Q  109 gcccttt 115  Q
     ||||||    
T  48327769 acccttt 48327763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 12 - 118
Target Start/End: Original strand, 25343218 - 25343327
Alignment:
Q  12 ctcttgtgtaaaaat-agggtaagggtgcgtacaatacacc--aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggtt 108  Q
    ||||||||||||||  ||||||||| |||||||||||||||  ||| ||| |||||||||||  || |||||| ||| | ||||||||| ||||| || |    
T  25343218 ctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaagggttggaccccttcctagatcctgcgtatgtgagagctttagagcacccggct 25343317  T
Q  109 gccctttttt 118  Q
    |||| |||||    
T  25343318 gccccttttt 25343327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 74
Target Start/End: Complemental strand, 35894548 - 35894502
Alignment:
Q  29 ggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccgga 74  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||    
T  35894548 ggtaagtgtgcgtacaatacaccaaaatggtgggaccccttcccgga 35894502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 53 - 118
Target Start/End: Original strand, 8820581 - 8820646
Alignment:
Q  53 aatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||||||||||||||||| ||||||||| ||||| ||| ||||||||| | | ||| ||||||||    
T  8820581 aatggtgggaccccttcccagaccctgcgtatgcgagagttttagtgcatcagattgtcctttttt 8820646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 36589763 - 36589876
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||| |||||||||||||||  | ||||| | ||   ||| ||||||||| |||||||||||||||| | |||||  | ||||||||||||| ||    
T  36589763 ctggaaacagcctcttgtgtaaaaaacatggtaatgctgttgacagtacaccaaaatggtgggaccccttcctgaaccctatgtatgcgggagctttggt 36589862  T
Q  99 gcaccgggttgccc 112  Q
    |||||||| |||||    
T  36589863 gcaccgggctgccc 36589876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 58 - 114
Target Start/End: Complemental strand, 12666914 - 12666858
Alignment:
Q  58 tgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctt 114  Q
    |||||||||||  |||||| |||| |||| ||||||||||| |||||||||||||||    
T  12666914 tgggaccccttgtcggaccatgcgtatgcaggagctttagtacaccgggttgccctt 12666858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 4 - 99
Target Start/End: Complemental strand, 32629380 - 32629285
Alignment:
Q  4 gaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaat-ggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||| ||||||||  ||||| |||||||||  || |||| |||||||||| || |||||||||||||||||| |||| ||| ||||| |||||||    
T  32629380 gaaacagcctcttgtaaaaaaacagggtaaggccgcctaca-tacaccaaattggcgggaccccttcccggaccttgcgtatgtgggagttttagtg 32629285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 2 - 52
Target Start/End: Original strand, 51420595 - 51420646
Alignment:
Q  2 tggaaacaacctcttgtgta-aaaatagggtaagggtgcgtacaatacacca 52  Q
    |||||||||||||||||||| |||| ||||||||| || |||||||||||||    
T  51420595 tggaaacaacctcttgtgtagaaaacagggtaaggctgggtacaatacacca 51420646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 75
Target Start/End: Complemental strand, 17079765 - 17079691
Alignment:
Q  2 tggaaacaacctcttgtgta-aaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggac 75  Q
    |||||||||  ||||||||| |||| ||||||||| ||| |||||||| | |||||||||||||| |||| ||||    
T  17079765 tggaaacaatatcttgtgtataaaacagggtaaggctgcatacaatacgctaaatggtgggaccctttcctggac 17079691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 40
Target Start/End: Complemental strand, 42164262 - 42164224
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcg 40  Q
    |||||||||||||||||||||||| ||||||||| ||||    
T  42164262 tggaaacaacctcttgtgtaaaaacagggtaaggctgcg 42164224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 66 - 103
Target Start/End: Complemental strand, 37038172 - 37038135
Alignment:
Q  66 cttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    ||||||| |||||||| |||||||||||||||||||||    
T  37038172 cttcccgtaccctgcgtatgcgggagctttagtgcacc 37038135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 54 - 114
Target Start/End: Original strand, 21003410 - 21003469
Alignment:
Q  54 atggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctt 114  Q
    |||||| |||| |||||| |||||||||  |||||||||||| |||||||||| |||||||    
T  21003410 atggtgtgacctcttcccagaccctgcgtgtgcgggagcttt-gtgcaccgggctgccctt 21003469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 44 - 118
Target Start/End: Original strand, 48033388 - 48033464
Alignment:
Q  44 aatacaccaaa-tggtggg-accccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||||||||| ||||||| |||||||   ||||| |||| ||||||||||||||||||||| | ||||| ||||||    
T  48033388 aatacaccaaaatggtggggacccctttgtggaccttgcgtatgcgggagctttagtgcacctgattgccttttttt 48033464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 92; Significance: 1e-44; HSPs: 72)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 9671201 - 9671315
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  9671201 ctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgc 9671299  T
Q  101 accgggttgccctttt 116  Q
    ||||||||||||||||    
T  9671300 accgggttgccctttt 9671315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 14444749 - 14444866
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||| ||||||||| || |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  14444749 ctggaaacagcctcttgtgtaaaaacagggtaaggctgtgtacgatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgc 14444848  T
Q  101 accgggttgccctttttt 118  Q
    ||| ||||||||||||||    
T  14444849 accaggttgccctttttt 14444866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 36871513 - 36871629
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| |||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||    
T  36871513 ctggaaacagcctcttgtgtgaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgga-cctgcgtatgcgggagctttagtgc 36871611  T
Q  101 accgggttgccctttttt 118  Q
    ||||||||||||||||||    
T  36871612 accgggttgccctttttt 36871629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 8455431 - 8455315
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| |||||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||    
T  8455431 ctggaaacagcctcttgtgtaaaacacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgccggagctttagtg 8455332  T
Q  100 caccgggttgccctttt 116  Q
    |||||||||||||||||    
T  8455331 caccgggttgccctttt 8455315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 10546182 - 10546301
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaata--gggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||| |||||||| |||||| |  |||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  10546182 ctggaaacatcctcttgtataaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagt 10546281  T
Q  99 gcaccgggttgccctttttt 118  Q
    ||||||||||||||||||||    
T  10546282 gcaccgggttgccctttttt 10546301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 2 - 118
Target Start/End: Complemental strand, 25249851 - 25249735
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    ||||||||  |||||||||| ||| ||||||||| |||||||||||||||||||||||||| ||||||||| |||||||| ||||| |||||||||||||    
T  25249851 tggaaacagtctcttgtgtacaaacagggtaaggctgcgtacaatacaccaaatggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgca 25249752  T
Q  102 ccgggttgccctttttt 118  Q
    |||||||||||||||||    
T  25249751 ccgggttgccctttttt 25249735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 17668022 - 17668141
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||| |||||||||||||||||| ||||||||| |||||||||||||||||||||||| |||||||| || |||||||| ||  |||||||||||||    
T  17668022 ctggaaagaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacaccaaatggtggaaccccttctcgaaccctgcgtatatgggagctttagtg 17668121  T
Q  100 caccgggttgccctttttta 119  Q
    ||||||||||||||||||||    
T  17668122 caccgggttgccctttttta 17668141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 21779374 - 21779260
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||| ||| ||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| ||||||    
T  21779374 ctggagacagcctcttgtgtaaaac-agggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgc 21779276  T
Q  101 accgggttgccctttt 116  Q
    ||||||||||||||||    
T  21779275 accgggttgccctttt 21779260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 10543718 - 10543835
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||  |||||||||||||||  ||||||||| ||||||||||||||||||  ||||||||||||||||||||||||||| |||||||||||||||    
T  10543718 ctggaaacggcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttag 10543817  T
Q  98 tgcaccgggttgcccttt 115  Q
    ||||||||||||||||||    
T  10543818 tgcaccgggttgcccttt 10543835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 4 - 119
Target Start/End: Original strand, 17623587 - 17623703
Alignment:
Q  4 gaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcac 102  Q
    ||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| ||||||||||| | |||||| ||| || |||||||||||||    
T  17623587 gaaacaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcac 17623686  T
Q  103 cgggttgccctttttta 119  Q
     ||||||||||||||||    
T  17623687 tgggttgccctttttta 17623703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 4 - 117
Target Start/End: Original strand, 17896282 - 17896397
Alignment:
Q  4 gaaacaacctcttgtgtaaaa--atagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||||||||||||||||||||  ||||||||||| ||||||||||| ||||||||||||||||||||| ||||||||||| ||| |||||||||||||||    
T  17896282 gaaacaacctcttgtgtaaaaaaatagggtaaggctgcgtacaatataccaaatggtgggaccccttctcggaccctgcgtatgtgggagctttagtgca 17896381  T
Q  102 ccgggttgcccttttt 117  Q
     || ||||||||||||    
T  17896382 tcgagttgcccttttt 17896397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 14530338 - 14530455
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||| ||||||  ||||||||| | |||||||||||||||  |||||||||||||||||||||||||||| |||||||||||||||    
T  14530338 ctggaaacagcctcttgtataaaaaacagggtaaggctacgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttag 14530437  T
Q  98 tgcaccgggttgcccttt 115  Q
    ||||||||||||||||||    
T  14530438 tgcaccgggttgcccttt 14530455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 23397786 - 23397899
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| |||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||| |||||||| |  ||||||||||| ||||||    
T  23397786 ctggaaacagcctcttgtgtaaaa-tagggtaaggctacgtacaatacaccaaatggtgggaccccttctcggaccctacatatgcgggagctctagtgc 23397884  T
Q  101 accgggttgcccttt 115  Q
    |||||||||||||||    
T  23397885 accgggttgcccttt 23397899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 4 - 115
Target Start/End: Complemental strand, 25079830 - 25079717
Alignment:
Q  4 gaaacaacctcttgtgtaaaaatag--ggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||||||||||||||||||||| |   ||||||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||  |||||||||||||    
T  25079830 gaaacaacctcttgtgtaaaaaaacaaggtaaggatgcgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaagagctttagtgca 25079731  T
Q  102 ccgggttgcccttt 115  Q
    ||||||||||||||    
T  25079730 ccgggttgcccttt 25079717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 40762349 - 40762234
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaata-gggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| |||||||||||||||   |||||||| | ||||||||||||||||||||||||||| |||| |||||||||| ||| |||||||||||||    
T  40762349 ctggaaacagcctcttgtgtaaaaaactgggtaaggctacgtacaatacaccaaatggtgggaccctttcctggaccctgcgtatgtgggagctttagtg 40762250  T
Q  100 caccgggttgcccttt 115  Q
    ||||||||||||||||    
T  40762249 caccgggttgcccttt 40762234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 39914421 - 39914305
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaata--gggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||||||||||||||||||| |  |||||||| || |||||||||||| |||||||||||||||||| | |||||||| ||||||||||||||||    
T  39914421 ctggaaacaacctcttgtgtaaaaaaacagggtaaggatgtgtacaatacaccgaatggtgggaccccttcctg-accctgcgtatgcgggagctttagt 39914323  T
Q  99 gcaccgggttgccctttt 116  Q
    ||| ||||||||||||||    
T  39914322 gcatcgggttgccctttt 39914305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 24860101 - 24859985
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||||||||| ||||||||| | |||| || |||||||||||||||||||||| | |||||||| ||||||||||| ||||||||||||||||||    
T  24860101 ctggaaacaacctctggtgtaaaaacatggta-ggctgcgtacaatacaccaaatggtagaaccccttctcggaccctgcgtatgcgggagctttagtgc 24860003  T
Q  101 accgggttgccctttttt 118  Q
    ||||| ||||| ||||||    
T  24860002 accggattgccttttttt 24859985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 11514456 - 11514571
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| |||||||||||||||  |  |||||| ||||||||||||||||||||||||||||| ||||| ||||||||| |||||||||||||||||    
T  11514456 ctggaaacagcctcttgtgtaaaaaacaaagtaaggctgcgtacaatacaccaaatggtgggaccc-ttcccagaccctgcgtatgcgggagctttagtg 11514554  T
Q  100 caccgggttgccctttt 116  Q
    |||||| ||||||||||    
T  11514555 caccggattgccctttt 11514571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 12024033 - 12023929
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||  || ||||||| |||    
T  12024033 ctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccctcccggaccctgcgtatttggaagctttaatgc 12023934  T
Q  101 accgg 105  Q
    |||||    
T  12023933 accgg 12023929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 2 - 118
Target Start/End: Original strand, 30826058 - 30826173
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||| |||||| |  |||||||||||||||||||    
T  30826058 tggaaacagcctcttgtgtaaaaatagggtaaggttgcgtacaatacaccaaatggt-ggaacccttcccagaccctacatatgcgggagctttagtgca 30826156  T
Q  102 ccgggttgccctttttt 118  Q
    || | ||| ||||||||    
T  30826157 ccagattgtcctttttt 30826173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 24200740 - 24200622
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||||||||||  ||||||||| ||||||||||||||||||  |||||||| |||||||||||||||| | ||| | |||||||||    
T  24200740 ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaacccttcccggaccctgagtatgtgagagctttag 24200641  T
Q  98 tgcaccgggttgccctttt 116  Q
    |||||||||||||||||||    
T  24200640 tgcaccgggttgccctttt 24200622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 2 - 115
Target Start/End: Complemental strand, 17380350 - 17380238
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||||||||||||||||||| ||| ||||||||| || || |||||||||||||| ||| ||||||||| |||||||||||||||||||||||| |||||    
T  17380350 tggaaacaacctcttgtgtataaacagggtaaggttgtgtgcaatacaccaaatgatggaaccccttcctggaccctgcggatgcgggagcttt-gtgca 17380252  T
Q  102 ccgggttgcccttt 115  Q
    ||||| | ||||||    
T  17380251 ccgggcttcccttt 17380238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 4 - 116
Target Start/End: Original strand, 5841051 - 5841166
Alignment:
Q  4 gaaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    |||||| ||| ||||||||||| |||||||||| ||||||||||||| |||  |||||||||||||||||||||||| ||  ||||||||||||||||||    
T  5841051 gaaacagccttttgtgtaaaaaatagggtaaggatgcgtacaatacatcaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgc 5841150  T
Q  101 accgggttgccctttt 116  Q
    |||| |||||||||||    
T  5841151 accgagttgccctttt 5841166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 19977829 - 19977710
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| |||||| |||||||| |||| ||||| |||||||||||||||||||||||||| ||||||||| ||| || | |||||||||||||||||    
T  19977829 ctggaaacagcctcttttgtaaaaaataggataaggttgcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttagtg 19977730  T
Q  100 caccgggttgccctttttta 119  Q
    |||| | || ||||||||||    
T  19977729 caccagattaccctttttta 19977710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 3 - 95
Target Start/End: Complemental strand, 32781401 - 32781308
Alignment:
Q  3 ggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagcttt 95  Q
    |||||||||||||||||||||||  ||||||||  ||||||||||||||||||||||||||||||||||| ||||||| | |||||||||||||    
T  32781401 ggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcccagaccctgtgtatgcgggagcttt 32781308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 21 - 116
Target Start/End: Original strand, 44643564 - 44643659
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    ||||| || |||||| ||||||||||  ||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||| |||||||||    
T  44643564 aaaaacagagtaaggctgcgtacaatgtaccaaatggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgccctttt 44643659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 4 - 117
Target Start/End: Complemental strand, 21377185 - 21377072
Alignment:
Q  4 gaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcac 102  Q
    |||||| |||||||||||||||  ||||||||| || ||||||| ||||||||||||||||||||||||| |||||||| ||| ||||||||| ||||||    
T  21377185 gaaacatcctcttgtgtaaaaaacagggtaaggctgggtacaatgcaccaaatggtgggaccccttcccgaaccctgcgtatgtgggagcttt-gtgcac 21377087  T
Q  103 cgggttgcccttttt 117  Q
    || | ||||||||||    
T  21377086 cgagctgcccttttt 21377072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 21 - 115
Target Start/End: Original strand, 25632550 - 25632644
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||| ||| ||||| ||||||||||||||||||||||||||  |||||||| ||| | || |||||||||||||||||||||||||||||||||    
T  25632550 aaaaacaggataaggctgcgtacaatacaccaaatggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgcccttt 25632644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 10 - 117
Target Start/End: Complemental strand, 26684727 - 26684618
Alignment:
Q  10 acctcttgtgtaaaaa--tagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggt 107  Q
    ||||||||||||||||  || ||||||| ||||||||||| || ||||||||||||| ||||||| |||||||| |||||||||||||| |||||||| |    
T  26684727 acctcttgtgtaaaaaaatatggtaaggctgcgtacaatatactaaatggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccggat 26684628  T
Q  108 tgcccttttt 117  Q
    || |||||||    
T  26684627 tgtccttttt 26684618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 4516463 - 4516354
Alignment:
Q  4 gaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcac 102  Q
    |||||| |||||||||||||||  |||| || | ||||||||||||||||| ||||||||||||||||||||||||||| ||| || |||||||||| ||    
T  4516463 gaaacagcctcttgtgtaaaaaacagggcaacgctgcgtacaatacaccaattggtgggaccccttcccggaccctgcgtatgtggaagctttagtgtac 4516364  T
Q  103 cgggttgccc 112  Q
    |||| |||||    
T  4516363 cgggctgccc 4516354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 25641522 - 25641639
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| | | |||||| |||| ||||||| | ||||||||||||||||||| |||||||||||||||| | |||||| ||||| |||||||||||     
T  25641522 ctggaaacagcattttgtgtgaaaacagggtaaagttgcgtacaatacaccaaattgtgggaccccttcccgaatcctgcgtatgcgagagctttagtga 25641621  T
Q  101 accgggttgccctttttt 118  Q
    ||||| ||| ||||||||    
T  25641622 accggattgtcctttttt 25641639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 22371077 - 22371153
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctg 79  Q
    ||||||||| ||||  ||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  22371077 ctggaaacagcctc--gtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg 22371153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 6 - 117
Target Start/End: Original strand, 27573646 - 27573757
Alignment:
Q  6 aacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgg 105  Q
    |||| ||||||||||| ||| | ||||||| |||||||||||||||||||||||| |||  |||||  |||||| | ||| ||||||||||||||| |||    
T  27573646 aacagcctcttgtgtataaacatggtaaggctgcgtacaatacaccaaatggtggaaccatttcccaaaccctgtgtatgtgggagctttagtgcatcgg 27573745  T
Q  106 gttgcccttttt 117  Q
    ||||||||||||    
T  27573746 gttgcccttttt 27573757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 2 - 105
Target Start/End: Complemental strand, 30864530 - 30864427
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||  || || |||||  |||||||| |||||| |||||  |||||    
T  30864530 tggaaacagcctcttgtgtaaaaatagggtaagggtgcgtacaatataccaaatggtaagatcctttcccaaaccctgcgtatgcggaagcttcggtgca 30864431  T
Q  102 ccgg 105  Q
    ||||    
T  30864430 ccgg 30864427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 29 - 102
Target Start/End: Original strand, 24890460 - 24890533
Alignment:
Q  29 ggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcac 102  Q
    ||||||| ||| ||||||||||||| ||||||||||||||||||||||||||| |||| |||||||||||||||    
T  24890460 ggtaaggctgcatacaatacaccaattggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac 24890533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 55 - 120
Target Start/End: Original strand, 34766330 - 34766395
Alignment:
Q  55 tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttttat 120  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |||||||||||    
T  34766330 tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggtttcccttttttat 34766395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 52 - 116
Target Start/End: Original strand, 23488555 - 23488619
Alignment:
Q  52 aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |||||    
T  23488555 aaatggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgctctttt 23488619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 7 - 103
Target Start/End: Complemental strand, 39499338 - 39499242
Alignment:
Q  7 acaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    |||||| ||||| |||||||||||||| | ||||||||||||| |||||||||||| |||||  || | |||||| |||||||||||||||||||||    
T  39499338 acaaccacttgtataaaaatagggtaaagctgcgtacaatacatcaaatggtgggatcccttttcgaatcctgcgtatgcgggagctttagtgcacc 39499242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 54 - 114
Target Start/End: Complemental strand, 40579810 - 40579750
Alignment:
Q  54 atggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctt 114  Q
    |||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||    
T  40579810 atggtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccctt 40579750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 2 - 115
Target Start/End: Complemental strand, 40416985 - 40416871
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||||||||||| ||||||  |||| |||| || |||||||||||||| || |||||||| ||   |||||||||  ||||| ||||||||||||    
T  40416985 tggaaacaacctcttgtataaaaaacagggaaaggctgtgtacaatacaccaattgatgggacccttttttggaccctgcatatgcgagagctttagtgc 40416886  T
Q  101 accgggttgcccttt 115  Q
    |||||||||||||||    
T  40416885 accgggttgcccttt 40416871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 29 - 114
Target Start/End: Complemental strand, 13245181 - 13245096
Alignment:
Q  29 ggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctt 114  Q
    ||||||| |||||||| ||||| ||||||||||||||||||||||||| |||  || |||||||||||||| | ||||||||||||    
T  13245181 ggtaaggctgcgtacattacactaaatggtgggaccccttcccggaccatgcatatacgggagctttagtgtatcgggttgccctt 13245096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 55 - 116
Target Start/End: Original strand, 34080176 - 34080237
Alignment:
Q  55 tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    ||||||||||||||||||||||||||  ||||||||| ||||||||||||||||||||||||    
T  34080176 tggtgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgccctttt 34080237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 5450305 - 5450384
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatag--ggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccct 78  Q
    ||||||||||||||||||||||||| |   ||||||| |||||||||||||||||| ||||||||||||||| |||||||    
T  5450305 ctggaaacaacctcttgtgtaaaaaaacatggtaaggctgcgtacaatacaccaaagggtgggaccccttcctggaccct 5450384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 14544083 - 14544201
Alignment:
Q  1 ctggaaacaacctcttgtgta--aaaatagggtaagggtgcgtacaata--caccaaatggtgggaccccttcccggaccctgcggatgcgggagcttta 96  Q
    ||||||||| |||||||||||  |||| ||||||||  ||||| |||||  ||  ||||||| ||||||||||| |||||||||| ||||||||||||||    
T  14544083 ctggaaacagcctcttgtgtagaaaaacagggtaagactgcgtgcaataaccaaaaaatggtcggaccccttccgggaccctgcgtatgcgggagcttta 14544182  T
Q  97 gtgcaccgggttgcccttt 115  Q
    |||||||  ||||||||||    
T  14544183 gtgcaccaagttgcccttt 14544201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 54 - 118
Target Start/End: Original strand, 41409936 - 41410000
Alignment:
Q  54 atggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||||||||||||||||||||||  |||||||||||| |||||||||||||||||| ||||    
T  41409936 atggtgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgccctctttt 41410000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 21 - 103
Target Start/End: Complemental strand, 31821437 - 31821355
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    ||||||||||||||| || ||||||||||||||||| ||||||||||| ||| | |||| | |||||||||||||| ||||||    
T  31821437 aaaaatagggtaaggttgtgtacaatacaccaaatgatgggacccctttccgaaacctgtgtatgcgggagctttaatgcacc 31821355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 67 - 116
Target Start/End: Original strand, 22371199 - 22371248
Alignment:
Q  67 ttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  22371199 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt 22371248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 2 - 118
Target Start/End: Original strand, 7214555 - 7214674
Alignment:
Q  2 tggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||  ||||||||||||| | ||||||||| |||||||||||||| |||  ||||| || |||||| ||||| ||||| ||||| ||| ||||||    
T  7214555 tggaaacagtctcttgtgtaaaatacagggtaaggctgcgtacaatacacaaaaaatggtgagatcccttctcggacactgcgtatgcgagagttttagt 7214654  T
Q  99 gcaccgggttgccctttttt 118  Q
    ||||| ||||||| ||||||    
T  7214655 gcaccaggttgccttttttt 7214674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 5 - 117
Target Start/End: Complemental strand, 31158552 - 31158437
Alignment:
Q  5 aaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    ||||| ||||||| |||||||  ||||||||  ||| ||||||| ||||||  ||||||||||||||||| ||||||||| |||||||||||||||| ||    
T  31158552 aaacagcctcttgcgtaaaaaacagggtaagattgcatacaataaaccaaaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtaca 31158453  T
Q  102 ccgggttgcccttttt 117  Q
    || | ||| |||||||    
T  31158452 cctgattgtccttttt 31158437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 32 - 99
Target Start/End: Complemental strand, 99348 - 99281
Alignment:
Q  32 aagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||| |||||||||||||||||||||||| |||||||| | ||||||| | |||||||||||||||||    
T  99348 aaggctgcgtacaatacaccaaatggtggaaccccttctcagaccctgtgtatgcgggagctttagtg 99281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 60 - 115
Target Start/End: Original strand, 8575975 - 8576030
Alignment:
Q  60 ggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    |||||||||||||||||||||| ||| ||||||||||||||||| |||||||||||    
T  8575975 ggaccccttcccggaccctgcgtatgtgggagctttagtgcaccaggttgcccttt 8576030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 3 - 95
Target Start/End: Original strand, 33795307 - 33795400
Alignment:
Q  3 ggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaa-tacaccaaatggtgggaccccttcccggaccctgcggatgcgggagcttt 95  Q
    ||||||||||||||| |||||||  ||||||||| ||||||||| |||||| | ||||||||||||||||| ||||||| | |||||||||||||    
T  33795307 ggaaacaacctcttgggtaaaaaacagggtaaggctgcgtacaaatacaccta-tggtgggaccccttcccagaccctgtgtatgcgggagcttt 33795400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 3 - 118
Target Start/End: Complemental strand, 15296520 - 15296403
Alignment:
Q  3 ggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||| ||| |||||||||| | ||||||||| ||||||||||| |||||| | |||||| |||||| ||||||||||| ||| || |||||| ||||    
T  15296520 ggaaacagcctgttgtgtaaaatacagggtaaggctgcgtacaatataccaaaatagtgggatcccttctcggaccctgcgtatgtggaagctttggtgc 15296421  T
Q  101 accgggttgccctttttt 118  Q
     || || |||||||||||    
T  15296420 gccaggctgccctttttt 15296403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 67 - 111
Target Start/End: Complemental strand, 124962 - 124918
Alignment:
Q  67 ttcccggaccctgcggatgcgggagctttagtgcaccgggttgcc 111  Q
    ||||||||||||||| |||||||||||||||||||||||||||||    
T  124962 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc 124918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 5 - 103
Target Start/End: Complemental strand, 44449495 - 44449395
Alignment:
Q  5 aaacaacctcttgtgt-aaaaatagggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcac 102  Q
    |||||||||||||  | ||||| ||| ||||| |||||||||||||||||| | |||||||||||||||||||||||||  || ||||| |||| |||||    
T  44449495 aaacaacctcttgaatgaaaaacaggataaggctgcgtacaatacaccaaaatagtgggaccccttcccggaccctgcgtttgtgggagttttaatgcac 44449396  T
Q  103 c 103  Q
    |    
T  44449395 c 44449395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 24 - 120
Target Start/End: Complemental strand, 45235908 - 45235812
Alignment:
Q  24 aatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttttat 120  Q
    |||||||||||| | |||  ||||||| ||||||||||||||||| || |||||| || |||| |||||||||||| |||  ||||||| |||||||    
T  45235908 aatagggtaaggctacgtgtaatacacaaaatggtgggaccccttaccagaccctacgtatgcaggagctttagtgtaccaagttgcccctttttat 45235812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 44 - 99
Target Start/End: Complemental strand, 24059067 - 24059012
Alignment:
Q  44 aatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| ||||||||||||||| |||||||||||| ||| |||||||||||||    
T  24059067 aatacaccatatggtgggacccctttccggaccctgcgtatgtgggagctttagtg 24059012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 61 - 115
Target Start/End: Complemental strand, 3633762 - 3633708
Alignment:
Q  61 gaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||||||||||||||| ||  |||||||||||||||||||||| ||||||||||    
T  3633762 gaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttt 3633708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 12 - 77
Target Start/End: Complemental strand, 23145802 - 23145736
Alignment:
Q  12 ctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccc 77  Q
    ||||||||||||||  || |||||| ||||||||||||||||| ||||||||||| |||||||||||    
T  23145802 ctcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaattggtgggaccctttcccggaccc 23145736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 12 - 77
Target Start/End: Complemental strand, 23557592 - 23557526
Alignment:
Q  12 ctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccc 77  Q
    ||||||||||||||  || |||||| ||||||||||||||||| ||||||||||| |||||||||||    
T  23557592 ctcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaattggtgggaccctttcccggaccc 23557526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 4 - 105
Target Start/End: Original strand, 17471571 - 17471675
Alignment:
Q  4 gaaacaacctcttgtgtaaaaata--gggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    |||||| ||||||||||||||| |  || ||||  ||||||||||| |||||| || || ||||||||||| ||||||||  ||||||||| ||||||||    
T  17471571 gaaacagcctcttgtgtaaaaaaacaggataagactgcgtacaatataccaaaatgatgagaccccttccctgaccctgcctatgcgggagttttagtgc 17471670  T
Q  101 accgg 105  Q
    |||||    
T  17471671 accgg 17471675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 53 - 116
Target Start/End: Original strand, 1289095 - 1289159
Alignment:
Q  53 aatggtgggaccccttcccggaccctgcggatgcgggagc-tttagtgcaccgggttgccctttt 116  Q
    |||||||||||||||||||||| | |||  |||||||||| ||||||||||||| ||||||||||    
T  1289095 aatggtgggaccccttcccggatcatgcatatgcgggagcttttagtgcaccggattgccctttt 1289159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 52 - 115
Target Start/End: Complemental strand, 19185806 - 19185743
Alignment:
Q  52 aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||||||| ||||||||| |||||||||| |||||||||||||||| || || ||| ||||||    
T  19185806 aaatggtggaaccccttcctggaccctgcgtatgcgggagctttagtacatcgagttacccttt 19185743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 4 - 103
Target Start/End: Original strand, 19615015 - 19615116
Alignment:
Q  4 gaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    |||||| |||||||| ||||||  ||||||||  ||||||||||| |||||  || |||| ||||||||||| |||||||| |||| |||||||||||||    
T  19615015 gaaacatcctcttgtataaaaaacagggtaagactgcgtacaatataccaataatagtgg-accccttcccgaaccctgcgtatgcaggagctttagtgc 19615113  T
Q  101 acc 103  Q
    |||    
T  19615114 acc 19615116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 45 - 112
Target Start/End: Original strand, 31525771 - 31525838
Alignment:
Q  45 atacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccc 112  Q
    |||||||||||| |||||||| || || ||||||||  ||||||||||||||||| ||||| ||||||    
T  31525771 atacaccaaatgatgggaccctttgccagaccctgcatatgcgggagctttagtgtaccggattgccc 31525838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 45 - 107
Target Start/End: Original strand, 31523296 - 31523358
Alignment:
Q  45 atacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggt 107  Q
    |||||||||||||||| |||| |||||  |||||||  |||||||||||||||||||| ||||    
T  31523296 atacaccaaatggtggaaccctttcccaaaccctgcatatgcgggagctttagtgcactgggt 31523358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 64 - 118
Target Start/End: Complemental strand, 39189555 - 39189501
Alignment:
Q  64 cccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||||||||| ||  ||||||||||| ||||||||||||||||| ||||||    
T  39189555 cccttcccggaccccgcatatgcgggagctctagtgcaccgggttgccttttttt 39189501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 102
Target Start/End: Original strand, 4794871 - 4794924
Alignment:
Q  49 accaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcac 102  Q
    |||||||| ||||||||||||||||| |||||  ||||||||||| ||||||||    
T  4794871 accaaatgatgggaccccttcccggatcctgcatatgcgggagctctagtgcac 4794924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 37 - 116
Target Start/End: Original strand, 4795811 - 4795891
Alignment:
Q  37 tgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    ||||| |||||||||||| ||||||||||  |||||||||| || | |||| | ||||||||||||  |||||||||||||    
T  4795811 tgcgtgcaatacaccaaaatggtgggaccttttcccggaccttgtgtatgccgaagctttagtgcagtgggttgccctttt 4795891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 2 - 96
Target Start/End: Complemental strand, 44521487 - 44521392
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagcttta 96  Q
    ||||||||| ||||||||||||||  | ||||||| ||| || |||||||||||||| |||| |||||||| |||  |||  || |||||||||||    
T  44521487 tggaaacaatctcttgtgtaaaaaacaaggtaaggctgcatataatacaccaaatggcgggagcccttcccagacattgcatatacgggagcttta 44521392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 44604874 - 44604907
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaag 34  Q
    ||||||||||||||||||||||||| ||||||||    
T  44604874 ctggaaacaacctcttgtgtaaaaacagggtaag 44604907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 74
Target Start/End: Original strand, 4252656 - 4252684
Alignment:
Q  46 tacaccaaatggtgggaccccttcccgga 74  Q
    |||||||||||||||||||||||||||||    
T  4252656 tacaccaaatggtgggaccccttcccgga 4252684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 90; Significance: 2e-43; HSPs: 62)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 45071285 - 45071398
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |||||    
T  45071285 ctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgc 45071384  T
Q  101 accgggttgccctt 114  Q
    ||||||||||||||    
T  45071385 accgggttgccctt 45071398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 4 - 115
Target Start/End: Original strand, 13160725 - 13160836
Alignment:
Q  4 gaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    |||||| ||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| ||    
T  13160725 gaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgcc 13160824  T
Q  104 gggttgcccttt 115  Q
    ||||||||||||    
T  13160825 gggttgcccttt 13160836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 35261699 - 35261818
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||  ||||||||||||||  ||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||    
T  35261699 ctggaaacagtctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtg 35261798  T
Q  100 caccgggttgccctttttta 119  Q
    ||||||||||||||||||||    
T  35261799 caccgggttgccctttttta 35261818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 2 - 116
Target Start/End: Original strand, 44530170 - 44530285
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||||||||||||||||||  ||||||||| |||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||    
T  44530170 tggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgc 44530269  T
Q  101 accgggttgccctttt 116  Q
    ||||||||| ||||||    
T  44530270 accgggttgacctttt 44530285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 28817741 - 28817624
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| |||||||||||||||  ||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||    
T  28817741 ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacccaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg 28817642  T
Q  100 caccgggttgcccttttt 117  Q
    || |||||||||||||||    
T  28817641 catcgggttgcccttttt 28817624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 36720816 - 36720932
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| |||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||    
T  36720816 ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtg 36720915  T
Q  100 caccgggttgccctttt 116  Q
    |||| ||||||||||||    
T  36720916 cacccggttgccctttt 36720932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 8897879 - 8897761
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||||| |||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||  |||||||||||||| ||    
T  8897879 ctggaaacaaccgcttgtgtaaaaaatagggtaaggctacgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttactg 8897780  T
Q  100 caccgggttgccctttttt 118  Q
    |||| ||||||||||||||    
T  8897779 cacccggttgccctttttt 8897761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 12625909 - 12626026
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaata--gggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||||||||||||||||||| |  |||||||  ||| |||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||    
T  12625909 ctggaaacaacctcttgtgtaaaaaaacagggtaagactgcatacaatacaccaaatggtgggaccccctcccggaccctgcgtatgcgggagctttagt 12626008  T
Q  99 gcaccgggttgccctttt 116  Q
    ||||||||||||||||||    
T  12626009 gcaccgggttgccctttt 12626026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 12670363 - 12670247
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| ||||||    
T  12670363 ctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgc 12670265  T
Q  101 accgggttgccctttttt 118  Q
    |||||||| |||||||||    
T  12670264 accgggttaccctttttt 12670247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 7136644 - 7136524
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    |||||||||||||||||||||||||  ||||||||| |||||||||||||||||  |||||||||||||||||||||||| ||  |||||||||||||||    
T  7136644 ctggaaacaacctcttgtgtaaaaaccagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttag 7136545  T
Q  98 tgcaccgggttgccctttttt 118  Q
    ||||||||||| |||||||||    
T  7136544 tgcaccgggttaccctttttt 7136524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 30454210 - 30454094
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||  ||||||||||| ||||||    
T  30454210 ctggaaacagcctcttgtgtaaaacaagg-taaggctgcgtacgatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgc 30454112  T
Q  101 accgggttgccctttttt 118  Q
    ||||||||||||||||||    
T  30454111 accgggttgccctttttt 30454094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 18164874 - 18164758
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||| ||||||||| |||||||||||||||||| | || ||||  ||||||||||||||| ||||||||||||||||||    
T  18164874 ctggaaacagcctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaaggatgtgaccatttcccggaccctgcgtatgcgggagctttagtgc 18164775  T
Q  101 accgggttgcccttttt 117  Q
    ||||||||||| |||||    
T  18164774 accgggttgccattttt 18164758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 39461111 - 39460988
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||||||||||  || |||||| |||||||||||||||||  |||||| ||||||||||||||||||||| |||||||||||||||    
T  39461111 ctggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgagaccccttcccggaccctgcgtatgcgggagctttag 39461012  T
Q  98 tgcaccgggttgcccttttttata 121  Q
    ||||||||||||||||||| ||||    
T  39461011 tgcaccgggttgcccttttatata 39460988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 5135404 - 5135288
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| |||||||||||||||  ||||||||| || |||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |||    
T  5135404 ctggaaacagcctcttgtgtaaaaaagagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcaggagcttt-gtg 5135306  T
Q  100 caccgggttgcccttttt 117  Q
    ||||||| ||||||||||    
T  5135305 caccgggctgcccttttt 5135288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 29877114 - 29877227
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| ||| |||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||    
T  29877114 ctggaaacagccttttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcgttagtg 29877213  T
Q  100 caccgggttgccct 113  Q
    |||| || ||||||    
T  29877214 caccaggctgccct 29877227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 29521800 - 29521685
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| |||||||| ||||||  ||||||||| |||||||||||||||||||||||||| ||| |||| ||||||||| |||||||||||||||||    
T  29521800 ctggaaacagcctcttgtttaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaacccatcccagaccctgcgtatgcgggagctttagtg 29521701  T
Q  100 caccgggttgcccttt 115  Q
    ||||||||||| ||||    
T  29521700 caccgggttgctcttt 29521685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 5 - 116
Target Start/End: Original strand, 31457197 - 31457308
Alignment:
Q  5 aaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccg 104  Q
    |||||||||||||||||||||||||  |||| ||||||||||||| |||||||| ||||||||||||  |||||||| ||||||||||| ||||||||||    
T  31457197 aaacaacctcttgtgtaaaaataggaaaaggctgcgtacaatacatcaaatggtaggaccccttcccaaaccctgcgtatgcgggagctctagtgcaccg 31457296  T
Q  105 ggttgccctttt 116  Q
    | ||||||||||    
T  31457297 gattgccctttt 31457308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 6760842 - 6760962
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||||||||||  ||||||||| | |||||||||||||||  |||||||||||||||| ||||||| ||  |||||||||||||||    
T  6760842 ctggaaacagcctcttgtgtaaaaaacagggtaaggcttcgtacaatacaccaataatggtgggaccccttctcggaccccgcatatgcgggagctttag 6760941  T
Q  98 tgcaccgggttgccctttttt 118  Q
    |||||||||||||||||||||    
T  6760942 tgcaccgggttgccctttttt 6760962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 20869943 - 20870063
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    |||||||||  ||||||||||||||  ||||||||| |||||||||||||||||  ||||||||||||||||| |||||| ||  |||||||||||||||    
T  20869943 ctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagctttag 20870042  T
Q  98 tgcaccgggttgccctttttt 118  Q
    |||||||||||||||||||||    
T  20870043 tgcaccgggttgccctttttt 20870063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 8484053 - 8483947
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||||||||||||||||||  |||| |||| ||||||||||||||||| |||||||||||| |||| ||||||||| ||||||||||||||| |    
T  8484053 ctggaaacaacctcttgtgtaaaaaacagggcaaggctgcgtacaatacaccaattggtgggaccccatcccagaccctgcgtatgcgggagctttaggg 8483954  T
Q  100 caccggg 106  Q
    |||||||    
T  8483953 caccggg 8483947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 11 - 117
Target Start/End: Original strand, 10857858 - 10857966
Alignment:
Q  11 cctcttgtgtaaaaata--gggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggtt 108  Q
    ||||||||||||||| |  |||||||| |||| |||||||||||| |||||||||| ||||| ||||| |||| ||||||||||||||||||||||||||    
T  10857858 cctcttgtgtaaaaaaacagggtaaggctgcgcacaatacaccaattggtgggaccacttcctggaccttgcgtatgcgggagctttagtgcaccgggtt 10857957  T
Q  109 gcccttttt 117  Q
    |||||||||    
T  10857958 gcccttttt 10857966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 41 - 118
Target Start/End: Original strand, 26102578 - 26102655
Alignment:
Q  41 tacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||||||||||||||||||||||||||||||||||||||  ||||||||||| ||||||||||||||||||||||||    
T  26102578 tacaatacaccaaatggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgccctttttt 26102655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 20284188 - 20284075
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaata---gggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagcttt 95  Q
    ||||||||| |||||||| |||||| |   |||||||| |||||||||||||||||  |||||||||||||||||||||||||||| ||||||||| |||    
T  20284188 ctggaaacagcctcttgtataaaaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagtttt 20284089  T
Q  96 agtgcaccgggttg 109  Q
    ||||||||||||||    
T  20284088 agtgcaccgggttg 20284075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 25250542 - 25250661
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| ||| ||||||||||| ||||||| || |||||||||||||||||  ||||||||||||||||||| |||| ||  ||||||||| |||||    
T  25250542 ctggaaacagcctattgtgtaaaaaatagggtatggctgcgtacaatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagatttag 25250641  T
Q  98 tgcaccgggttgcccttttt 117  Q
    ||||||||||||||||||||    
T  25250642 tgcaccgggttgcccttttt 25250661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 17823596 - 17823711
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| |||||||||||||||  ||| ||||  |||||| ||||||||||||||||| ||||||||||| |||||||  |||| ||||||||||||    
T  17823596 ctggaaacagcctcttgtgtaaaaaccaggataagactgcgtaaaatacaccaaatggtggaaccccttcccgaaccctgcatatgcaggagctttagtg 17823695  T
Q  100 caccgggttgcccttt 115  Q
    ||||||||||||||||    
T  17823696 caccgggttgcccttt 17823711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 21 - 109
Target Start/End: Complemental strand, 21070793 - 21070703
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttg 109  Q
    ||||| ||||||||| |||||||||||||||||  |||||||||||||||||||||||||||| ||||||||| |||||||||||||||||    
T  21070793 aaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg 21070703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 44742634 - 44742516
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    |||||||||| ||| ||||||||||  ||||||||| |||||||||||||||||| |||||||||||||||  ||||||| ||||||||||||| |||||    
T  44742634 ctggaaacaatctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcttggaccctacggatgcgggagcattagt 44742535  T
Q  99 gcaccgggttgcccttttt 117  Q
    |||||||| ||||| ||||    
T  44742534 gcaccggggtgcccctttt 44742516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 26954152 - 26954271
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaata--gggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagcttta 96  Q
    ||||||||| ||||||||||||||| |  |||||||| |||||||||||||||||  |||||||||||||||||| ||||  ||  ||||||||||||||    
T  26954152 ctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagacctcgcatatgcgggagcttta 26954251  T
Q  97 gtgcaccgggttgccctttt 116  Q
    |||||| |||||||||||||    
T  26954252 gtgcactgggttgccctttt 26954271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 11 - 110
Target Start/End: Original strand, 5689661 - 5689761
Alignment:
Q  11 cctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttg 109  Q
    |||||||||||||||  ||||||||| |||||||||||||||||||||||| ||||||||||| ||| |||| ||| ||||||||||||||||||| |||    
T  5689661 cctcttgtgtaaaaagcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaaccatgcgtatgtgggagctttagtgcaccggtttg 5689760  T
Q  110 c 110  Q
    |    
T  5689761 c 5689761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 4 - 104
Target Start/End: Complemental strand, 24365172 - 24365071
Alignment:
Q  4 gaaacaacctcttgtgtaaaaat--agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||||| |||||||||||||||   ||||||||| |||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||    
T  24365172 gaaacagcctcttgtgtaaaaaatcagggtaaggctgcgaacaatacaccaaatggtgggaccccttcccggaccctgcgtatgtgggagcttt-gtgca 24365074  T
Q  102 ccg 104  Q
    |||    
T  24365073 ccg 24365071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 389663 - 389783
Alignment:
Q  1 ctggaaacaacctcttgtgt---aaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| ||||||||||   ||||| ||||||||| |||||||||||||||||||| ||||| ||||| || ||||||||| ||||| |||||||||    
T  389663 ctggaaacaccctcttgtgtcaaaaaaacagggtaaggttgcgtacaatacaccaaatgatgggatccctttcctgaccctgcgtatgcgagagctttag 389762  T
Q  98 tgcaccgggttgccctttttt 118  Q
    |||||||| || || ||||||    
T  389763 tgcaccggattaccttttttt 389783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 22 - 116
Target Start/End: Original strand, 19729382 - 19729476
Alignment:
Q  22 aaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    |||| ||||||||| || |||||||||||||||||||||||||||||||||||||||||  || |||||||| |||||||| || ||||||||||    
T  19729382 aaaacagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatacgggagctctagtgcactggattgccctttt 19729476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 23000333 - 23000228
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||| | ||||||| | | ||||||||||||||||||||||||||||||         |||||||||||||||||||||    
T  23000333 ctggaaacagcctcttgtgtaaaaacacggtaaggttccatacaatacaccaaatggtgggaccccttcc---------cggatgcgggagctttagtgc 23000243  T
Q  101 accgggttgcccttt 115  Q
    |||||||||||||||    
T  23000242 accgggttgcccttt 23000228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 2626539 - 2626657
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaata----gggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagcttta 96  Q
    ||||||||| ||||||||||||||| |    |||||||  |||||||||||||||||||| |||||||||||||| ||||||||  |||||||||||| |    
T  2626539 ctggaaacagcctcttgtgtaaaaaaaaacagggtaagactgcgtacaatacaccaaatgatgggaccccttcccagaccctgcatatgcgggagcttca 2626638  T
Q  97 gtgcaccgggttgcccttt 115  Q
    ||||||| | |||||||||    
T  2626639 gtgcaccagattgcccttt 2626657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 44781621 - 44781517
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    |||||||||||||||||||||||| | ||||||||| || |||||||||||||||  || ||||||||| |||| ||||||||| |||||||||||||||    
T  44781621 ctggaaacaacctcttgtgtaaaagacagggtaaggctgtgtacaatacaccaaaaatgttgggaccccgtcccagaccctgcgtatgcgggagctttag 44781522  T
Q  98 tgcac 102  Q
    |||||    
T  44781521 tgcac 44781517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 48 - 115
Target Start/End: Original strand, 28407471 - 28407538
Alignment:
Q  48 caccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||    
T  28407471 caccaaatggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgcccttt 28407538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 21 - 115
Target Start/End: Original strand, 16225060 - 16225156
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||| ||||||||  |||||||||||||||||  ||||||||| |||||||||||||| ||  ||||||||||||||||||||||||||| |||||    
T  16225060 aaaaacagggtaagactgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcaccgggttgtccttt 16225156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 22598177 - 22598279
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||||||||||||||||||  ||||||||| |  |||||||||||||| ||||| ||||| |||||||||| |||| |||||||| ||||||||    
T  22598177 ctggaaacaacctcttgtgtaaaaaacagggtaaggctatgtacaatacaccaattggtgagaccctttcccggaccttgcgtatgcggga-ctttagtg 22598275  T
Q  100 cacc 103  Q
    ||||    
T  22598276 cacc 22598279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 24 - 117
Target Start/End: Original strand, 26457773 - 26457864
Alignment:
Q  24 aatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttt 117  Q
    |||||||||||| ||||||||||||||||| |||||||||||||  || |||| |||| ||| |||||||||||||||||||||| || |||||    
T  26457773 aatagggtaaggctgcgtacaatacaccaattggtgggacccct--cctgaccttgcgtatgagggagctttagtgcaccgggtttcctttttt 26457864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 66 - 118
Target Start/End: Complemental strand, 27468141 - 27468089
Alignment:
Q  66 cttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  27468141 cttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt 27468089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 52 - 116
Target Start/End: Complemental strand, 35107374 - 35107310
Alignment:
Q  52 aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    |||||||||||||||||||||||| ||| | |||||| |||||||||||||||||||||||||||    
T  35107374 aaatggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgccctttt 35107310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 37 - 117
Target Start/End: Original strand, 16013511 - 16013593
Alignment:
Q  37 tgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttt 117  Q
    |||||||||||||| |||  ||||| ||||||||||| ||||||||  ||||||||||||||||||||||||||| |||||||    
T  16013511 tgcgtacaatacactaaaaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttgtccttttt 16013593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 55 - 114
Target Start/End: Original strand, 27507985 - 27508044
Alignment:
Q  55 tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctt 114  Q
    |||||||||||||||||| |||||||| ||||||||||||||||||||||||||| ||||    
T  27507985 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgtcctt 27508044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 20869611 - 20869523
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagc 92  Q
    ||||||||| ||||||||||||||  ||||||||| || ||||||||||||||  |||| ||||||||||||||||||||  ||||||||||    
T  20869611 ctggaaacagcctcttgtgtaaaac-agggtaaggctgtgtacaatacaccaa--ggtgagaccccttcccggaccctgcatatgcgggagc 20869523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 17250992 - 17250879
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    |||||| || |||||||||||||||  ||| |||||  ||||||||||||||||  |||||||||||| |||||| |||||||| |||  ||||||||||    
T  17250992 ctggaagcagcctcttgtgtaaaaaacaggttaaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaaggagctttag 17250893  T
Q  98 tgcaccgggttgccc 112  Q
    |||| ||||||||||    
T  17250892 tgca-cgggttgccc 17250879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 35105943 - 35106022
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacacca-aatggtgggaccccttcccggaccct 78  Q
    |||||||||||||||||||||||| | || |||||| |||||||||||||||| |||||||||||| ||||| |||||||    
T  35105943 ctggaaacaacctcttgtgtaaaagagagtgtaaggctgcgtacaatacaccagaatggtgggacctcttcctggaccct 35106022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 54 - 114
Target Start/End: Complemental strand, 36486627 - 36486567
Alignment:
Q  54 atggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctt 114  Q
    ||||||||||| ||||||||||| |||| |||| ||||||||||||| |||||||||||||    
T  36486627 atggtgggacctcttcccggaccttgcgtatgcaggagctttagtgccccgggttgccctt 36486567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 2 - 116
Target Start/End: Complemental strand, 40605019 - 40604905
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| || ||||||||||| | || ||||| |||||||||||||| ||||| ||| | |||||||   ||||| || ||||||||||||||||||    
T  40605019 tggaaacaatcttttgtgtaaaaaattggataaggttgcgtacaatacactaaatgatgg-atcccttccgaaaccctacgtatgcgggagctttagtgc 40604921  T
Q  101 accgggttgccctttt 116  Q
    ||||  ||||||||||    
T  40604920 accgaattgccctttt 40604905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 42083814 - 42083699
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||| ||| ||||||||||| | ||| |||| |||||||| || |||||| |||||||||||||||||| |||||| | | | ||||||||||||    
T  42083814 ctggaaacagccttttgtgtaaaaaatggggcaaggctgcgtacagtataccaaaatggtgggaccccttcccgaaccctgtgtacgtgggagctttagt 42083715  T
Q  99 gcaccgggttgccctt 114  Q
    |||  ||| |||||||    
T  42083714 gcattgggctgccctt 42083699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 60 - 118
Target Start/End: Original strand, 18595918 - 18595976
Alignment:
Q  60 ggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||||||||||||||| | ||||||||| ||||||||| ||||||||| ||||||    
T  18595918 ggaccccttcccggaccctgtgtatgcgggagttttagtgcatcgggttgccttttttt 18595976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 94
Target Start/End: Complemental strand, 14018083 - 14017989
Alignment:
Q  2 tggaaacaacctcttgtgta-aaaatagggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctt 94  Q
    ||||||||  |||||||||| |||| ||||| ||  |||||||||||||| ||| |||||||||| ||||| ||||||||| ||||||| |||||    
T  14018083 tggaaacagtctcttgtgtaaaaaacagggtgagactgcgtacaatacactaaattggtgggaccacttcctggaccctgcagatgcggtagctt 14017989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 11 - 65
Target Start/End: Complemental strand, 23286428 - 23286375
Alignment:
Q  11 cctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccc 65  Q
    ||||||||||||||  ||||||| | |||||||||||||||||||||||||||||    
T  23286428 cctcttgtgtaaaac-agggtaaagctgcgtacaatacaccaaatggtgggaccc 23286375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 5 - 71
Target Start/End: Original strand, 43942348 - 43942417
Alignment:
Q  5 aaacaacctcttgtgt-aaaaatagggtaagggtgcgtacaatacacc--aaatggtgggaccccttccc 71  Q
    ||||| |||||| ||| ||||| ||||||||| |||||||||||||||  ||||||||||||||||||||    
T  43942348 aaacagcctcttatgtcaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttccc 43942417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 66 - 115
Target Start/End: Original strand, 33867038 - 33867087
Alignment:
Q  66 cttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||||| |||||||| |||| | ||||||||||||||||||||||||||    
T  33867038 cttcccgaaccctgcgtatgcagaagctttagtgcaccgggttgcccttt 33867087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 59 - 116
Target Start/End: Original strand, 40444845 - 40444902
Alignment:
Q  59 gggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    |||||||||| |||||||||||| |||  ||||||||||||||||| | |||||||||    
T  40444845 gggaccccttgccggaccctgcgtatgttggagctttagtgcaccgagctgccctttt 40444902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 52 - 119
Target Start/End: Complemental strand, 2351781 - 2351717
Alignment:
Q  52 aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttta 119  Q
    |||||||||||||| ||||  ||||||||  |||||||||||||||||||||| |||| |||||||||    
T  2351781 aaatggtgggaccc-ttcctagaccctgc--atgcgggagctttagtgcaccgagttgtcctttttta 2351717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 11001033 - 11000985
Alignment:
Q  31 taagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctg 79  Q
    ||||| || |||||||||||||||||||||||||||| |||| ||||||    
T  11001033 taaggctgtgtacaatacaccaaatggtgggacccctacccgaaccctg 11000985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 52 - 96
Target Start/End: Original strand, 24245521 - 24245565
Alignment:
Q  52 aaatggtgggaccccttcccggaccctgcggatgcgggagcttta 96  Q
    |||| |||||||||||||| |||||||||| ||||||||||||||    
T  24245521 aaattgtgggaccccttcctggaccctgcgtatgcgggagcttta 24245565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 71 - 115
Target Start/End: Complemental strand, 30962815 - 30962771
Alignment:
Q  71 cggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||||||||| ||||||||| ||||||| |||||||||||||||    
T  30962815 cggaccctgcgtatgcgggagatttagtgaaccgggttgcccttt 30962771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 65 - 116
Target Start/End: Original strand, 27635064 - 27635115
Alignment:
Q  65 ccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    ||||||| ||||||| | | |||||||||||||||||||||||| |||||||    
T  27635064 ccttcccagaccctgtgaaagcgggagctttagtgcaccgggtttccctttt 27635115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 58 - 118
Target Start/End: Original strand, 2677618 - 2677678
Alignment:
Q  58 tgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||||||| ||||||||||| ||||||  | ||||||||||||| |  |||||||||    
T  2677618 tgggaccccttctcggaccctgcgtatgcggatgttttagtgcaccggctgcccctttttt 2677678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 28873242 - 28873274
Alignment:
Q  24 aatagggtaagggtgcgtacaatacaccaaatg 56  Q
    |||||||||||| ||||||||||||||||||||    
T  28873242 aatagggtaaggttgcgtacaatacaccaaatg 28873274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 89; Significance: 6e-43; HSPs: 75)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 18512567 - 18512455
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||||| ||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| ||||    
T  18512567 ctggaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgc 18512468  T
Q  101 accgggttgccct 113  Q
    || ||||||||||    
T  18512467 actgggttgccct 18512455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 7879658 - 7879776
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||| ||||||||||||||  | ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||    
T  7879658 ctggaaacaatctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtg 7879757  T
Q  100 caccgggttgccctttttt 118  Q
    |||||||||||||||||||    
T  7879758 caccgggttgccctttttt 7879776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 21172122 - 21172008
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| ||||||    
T  21172122 ctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgc 21172024  T
Q  101 accgggttgccctttt 116  Q
    ||||||||||||||||    
T  21172023 accgggttgccctttt 21172008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 32758281 - 32758397
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||||||||| || |||||||||||||||||||||||||||||||||||||||||  ||||||||||| ||||||    
T  32758281 ctggaaacagcctcttgtgtaaaac-agggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgc 32758379  T
Q  101 accgggttgccctttttt 118  Q
    ||||||||||||||||||    
T  32758380 accgggttgccctttttt 32758397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 34626322 - 34626205
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| |||| |||||||||| ||||||||| ||||| |||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |    
T  34626322 ctggaaacagcctcctgtgtaaaaacagggtaaggctgcgttcaatacaccaaatggtgggatcccttcccggaccctgcgtatgcgggagctttagttc 34626223  T
Q  101 accgggttgccctttttt 118  Q
    | ||||||||||||||||    
T  34626222 atcgggttgccctttttt 34626205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 42391213 - 42391097
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| | ||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| ||||||    
T  42391213 ctggaaacagcttcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgc 42391115  T
Q  101 accgggttgccctttttt 118  Q
    ||||||||||||||||||    
T  42391114 accgggttgccctttttt 42391097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 2 - 115
Target Start/End: Complemental strand, 48735234 - 48735122
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||||||||||||||||||||||  | ||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| |||||||    
T  48735234 tggaaacaacctcttgtgtaaaac-acggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 48735136  T
Q  102 ccgggttgcccttt 115  Q
    ||||||||||||||    
T  48735135 ccgggttgcccttt 48735122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 2541134 - 2541019
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| |||||||||||||||  ||||||||| ||||||| ||||||||||||||||||||||||||||| ||||||| |||||||||||||||||    
T  2541134 ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtactatacaccaaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtg 2541035  T
Q  100 caccgggttgcccttt 115  Q
    ||||||||| ||||||    
T  2541034 caccgggtttcccttt 2541019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 10693186 - 10693073
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| ||||||    
T  10693186 ctggaaacagcctcttgtgtaaaag-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgc 10693088  T
Q  101 accgggttgcccttt 115  Q
    || ||||||||||||    
T  10693087 actgggttgcccttt 10693073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 11617703 - 11617589
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||||||||||||||||||  ||||||||  |||||||||||||||||||||||||||||||||| |||||||||| |||| ||| ||||||||    
T  11617703 ctggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcaggacctttagtg 11617604  T
Q  100 caccgggttgccctt 114  Q
    |||||||||||||||    
T  11617603 caccgggttgccctt 11617589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 33872024 - 33871914
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||||||||||||||||||| ||| ||||| ||||||||||||||||||||||||||||||||||| ||||||| | ||||| ||||||||||||    
T  33872024 ctggaaacaacctcttgtgtaaaaacaggataaggctgcgtacaatacaccaaatggtgggaccccttcccagaccctgtgtatgcgagagctttagtgc 33871925  T
Q  101 accgggttgcc 111  Q
    ||| |||||||    
T  33871924 accaggttgcc 33871914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 38604547 - 38604654
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagcttt-agtg 99  Q
    ||||||||| ||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||| |||||||||||| ||||||||||||| ||||    
T  38604547 ctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgagacccctttccggaccctgcgtatgcgggagctttaagtg 38604646  T
Q  100 caccgggt 107  Q
    ||||||||    
T  38604647 caccgggt 38604654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 6 - 116
Target Start/End: Complemental strand, 35787378 - 35787268
Alignment:
Q  6 aacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgg 105  Q
    |||| ||||||||||||||| | ||||||| ||||||||||||||||||||| |||||||||||||||||| |||| |||||||||||| | ||||||||    
T  35787378 aacagcctcttgtgtaaaaacatggtaaggttgcgtacaatacaccaaatggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccgg 35787279  T
Q  106 gttgccctttt 116  Q
    |||||||||||    
T  35787278 gttgccctttt 35787268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 27629654 - 27629771
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| |||||||||||||||  ||||||||| |||||| |||||||||||||||||||||||||||||| ||||||  |||||| ||||| ||||    
T  27629654 ctggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtaaaatacaccaaatggtgggaccccttcccgggccctgcatatgcggtagcttcagtg 27629753  T
Q  100 caccgggttgcccttttt 117  Q
    ||||||||||||||||||    
T  27629754 caccgggttgcccttttt 27629771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 12 - 116
Target Start/End: Original strand, 40463908 - 40464012
Alignment:
Q  12 ctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcc 111  Q
    ||||||||||||||  |||||||| |||||| |||||||||||||||||||||||||| ||||||||||| |||||||||||| ||||||||| ||||||    
T  40463908 ctcttgtgtaaaaactgggtaaggctgcgtataatacaccaaatggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccgagttgcc 40464007  T
Q  112 ctttt 116  Q
    |||||    
T  40464008 ctttt 40464012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 42805544 - 42805663
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||||||||||  ||||||||| || ||||||||||||||  |||||||||||||||||||||||| ||  |||||||||||||||    
T  42805544 ctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttag 42805643  T
Q  98 tgcaccgggttgcccttttt 117  Q
    ||||||||||||||||||||    
T  42805644 tgcaccgggttgcccttttt 42805663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 32 - 119
Target Start/End: Complemental strand, 27889399 - 27889312
Alignment:
Q  32 aagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttta 119  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || ||||||||||||||||||||    
T  27889399 aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgccctttttta 27889312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 31591222 - 31591108
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||||||||||||||||||  || |||||| |||||||||||||  ||||||||||||||||||||||||| |||  ||||||||||| ||||||    
T  31591222 ctggaaacaacctcttgtgtaaaac-agagtaaggctgcgtacaatacaataaatggtgggaccccttcccggaccttgcatatgcgggagctctagtgc 31591124  T
Q  101 accgggttgccctttt 116  Q
    ||||||||||||||||    
T  31591123 accgggttgccctttt 31591108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 19427004 - 19426887
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| ||||||||||||||| |||||||||  |||||||||||||||||||||||||| |||||| ||||||||||  ||||| |||||| ||||    
T  19427004 ctggaaacagcctcttgtgtaaaaaatagggtaagactgcgtacaatacaccaaatggtggga-cccttctcggaccctgcatatgcgagagcttcagtg 19426906  T
Q  100 caccgggttgccctttttt 118  Q
    |||||||||||||||||||    
T  19426905 caccgggttgccctttttt 19426887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 47716479 - 47716596
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||||||||||  ||||||||| |||||||||||||||||  |||||||||||||||||||||||| ||  ||||||||||||| |    
T  47716479 ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttgg 47716578  T
Q  98 tgcaccgggttgcccttt 115  Q
    ||||||||||||||||||    
T  47716579 tgcaccgggttgcccttt 47716596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 14 - 118
Target Start/End: Original strand, 19265848 - 19265951
Alignment:
Q  14 cttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccct 113  Q
    |||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| ||| |  ||| |||||||||||||||||||| ||||||    
T  19265848 cttgtgtaaaaagagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgga-cctacatatgtgggagctttagtgcaccgggctgccct 19265946  T
Q  114 ttttt 118  Q
    |||||    
T  19265947 ttttt 19265951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 2 - 117
Target Start/End: Original strand, 42798690 - 42798806
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||  ||||||||||||||  | ||||||| ||||||||||||||||||||||||||||| ||||||||||||||  ||||||||||| ||||||    
T  42798690 tggaaacagtctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccctttcccggaccctgcatatgcgggagctatagtgc 42798789  T
Q  101 accgggttgcccttttt 117  Q
    | |||||||||||||||    
T  42798790 atcgggttgcccttttt 42798806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 38262311 - 38262193
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||  |||||||||||||| || ||||| | ||| |||||||||||||||| ||||||||||||||| || ||||| |||||||||||||||||    
T  38262311 ctggaaacagtctcttgtgtaaaaaatatggtaatgttgcatacaatacaccaaatgatgggaccccttcccgaacactgcgtatgcgggagctttagtg 38262212  T
Q  100 caccgggttgccctttttt 118  Q
    |||||| ||||||||||||    
T  38262211 caccggattgccctttttt 38262193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 43557492 - 43557613
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagc-ttta 96  Q
    ||||||||| |||||||||||||||  || |||||| |||||||||||||||||  ||||||||||||| |||||||| ||||| |||||||||| ||||    
T  43557492 ctggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgggaccccctcccggactctgcgtatgcgggagctttta 43557591  T
Q  97 gtgcaccgggttgccctttttt 118  Q
    ||||||||||||||||||||||    
T  43557592 gtgcaccgggttgccctttttt 43557613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 22 - 114
Target Start/End: Original strand, 11741835 - 11741927
Alignment:
Q  22 aaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctt 114  Q
    |||||||||||||| |||||||||||||||||||||||||| |||||||||||  ||||  ||||||||||| ||||||||||||||||||||    
T  11741835 aaaatagggtaaggctgcgtacaatacaccaaatggtgggatcccttcccggattctgcacatgcgggagctctagtgcaccgggttgccctt 11741927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 2 - 114
Target Start/End: Original strand, 18747507 - 18747621
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaat--agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||| ||| |||||||||||   ||||||||| |||||| |||||||||| |||||||||||||||| | |||||||| |||||||||||||||||    
T  18747507 tggaaacagccttttgtgtaaaaaagcagggtaaggctgcgtataatacaccaattggtgggaccccttcctgaaccctgcgtatgcgggagctttagtg 18747606  T
Q  100 caccgggttgccctt 114  Q
    ||||||| |||||||    
T  18747607 caccgggctgccctt 18747621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 4 - 114
Target Start/End: Original strand, 29907442 - 29907552
Alignment:
Q  4 gaaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||||| ||||||||||||||| ||| |||||| ||||| |||||||||||| |||||||||||| ||||||||||||   |||||||||||||||||||    
T  29907442 gaaacagcctcttgtgtaaaaaatagtgtaaggctgcgttcaatacaccaaaatggtgggaccccatcccggaccctgt--atgcgggagctttagtgca 29907539  T
Q  102 ccgggttgccctt 114  Q
    |||||||||||||    
T  29907540 ccgggttgccctt 29907552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 32233249 - 32233132
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||||||||||||||||||| |||||||||  ||||| | |||||||||||||||||  |||||||  |||||||  ||| |||||||| |||||    
T  32233249 ctggaaacaacctcttgtgtaaaaacagggtaaggcagcgtatattacaccaaatggtgggattccttcccaaaccctgcatatgagggagcttcagtgc 32233150  T
Q  101 accgggttgccctttttt 118  Q
    |||||| |||||||||||    
T  32233149 accgggctgccctttttt 32233132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 21 - 113
Target Start/End: Complemental strand, 35334910 - 35334818
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccct 113  Q
    ||||| ||||||||  || |||||||||||| ||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||    
T  35334910 aaaaacagggtaagactgtgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggtttccct 35334818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 23231577 - 23231692
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||| | |||||||||||||| ||| ||||||| |||||| |||||||| |||| ||||||||||||||| |||||||| |||||| ||||||||||    
T  23231577 ctggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagctttagtg 23231676  T
Q  100 caccgggttgcccttt 115  Q
    ||||| ||| ||||||    
T  23231677 caccgagtttcccttt 23231692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 23419789 - 23419674
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| |||||||||||||||  ||||||||  ||||||||||||||||||||||||||||||||||  |||| ||||  |||||| |||||||||    
T  23419789 ctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcctagaccttgcgtgtgcgggggctttagtg 23419690  T
Q  100 caccgggttgcccttt 115  Q
    || |||| ||||||||    
T  23419689 catcgggctgcccttt 23419674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 13805122 - 13805243
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||| | ||||| ||||||||   |||||||| || ||||||||||||||||||||||||| ||||| |||||||||| ||||||||||||| ||||    
T  13805122 ctggaaatagcctctggtgtaaaacaggggtaaggctgtgtacaatacaccaaatggtgggaccacttcctggaccctgcgtatgcgggagcttt-gtgc 13805220  T
Q  101 accgggttgcccttttttataca 123  Q
    || ||| | ||||||||||||||    
T  13805221 actgggctacccttttttataca 13805243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 1408477 - 1408595
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||| | |||||||||||||||  | ||||||| || |||||||||| ||||||||||||||||||||||||||||||| |||| | | |||||||     
T  1408477 ctggaaatagcctcttgtgtaaaaaacaaggtaaggctgtgtacaatacagcaaatggtgggaccccttcccggaccctgcgtatgcagaatctttagtt 1408576  T
Q  100 caccgggttgccctttttt 118  Q
    |||||| ||||| ||||||    
T  1408577 caccggattgccttttttt 1408595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 21 - 94
Target Start/End: Original strand, 19266491 - 19266564
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctt 94  Q
    ||||| ||||||||| ||||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||    
T  19266491 aaaaacagggtaaggctgcgtacaatacaccaaattgtgggatcccttcccggaccctgcgtatgcgggagctt 19266564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 42476893 - 42477005
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    |||||||||  |||||||||||||  ||| ||||| ||||||||||||||||||||||||||||||||||  | | ||||  ||||||||||| ||||||    
T  42476893 ctggaaacagtctcttgtgtaaaacaagg-taaggctgcgtacaatacaccaaatggtgggaccccttcctaggctctgcatatgcgggagctctagtgc 42476991  T
Q  101 accgggttgccctt 114  Q
    ||| ||||||||||    
T  42476992 accaggttgccctt 42477005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 47077968 - 47077852
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    |||||||||  ||||||||||||| ||| |||| | |||||||||||||| ||||||||||||||||||||  ||||| |  ||||||||||| ||||||    
T  47077968 ctggaaacagtctcttgtgtaaaa-tagagtaaagttgcgtacaatacacaaaatggtgggaccccttcccaaaccctacatatgcgggagctctagtgc 47077870  T
Q  101 accgggttgccctttttt 118  Q
    ||||| ||||| ||||||    
T  47077869 accggattgccttttttt 47077852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 2663048 - 2662946
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||||||| |||||  | ||||||||  ||||||||||| ||| ||    
T  2663048 ctggaaacagcctcttgtgtaaaa-tagggtaaggctgcgtacaatacaccaaatggtggga-cccttttcagaccctgcatatgcgggagctctagcgc 2662951  T
Q  101 accgg 105  Q
    |||||    
T  2662950 accgg 2662946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 46354214 - 46354293
Alignment:
Q  1 ctggaaacaacctcttgtgt-aaaaatagggtaagggtgcgtacaatacacca--aatggtgggaccccttcccggaccc 77  Q
    |||||||||||||||||||| ||||| ||||||||| ||||||||||||||||  |||||||||||||||||||||||||    
T  46354214 ctggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccc 46354293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 5 - 101
Target Start/End: Complemental strand, 8149057 - 8148960
Alignment:
Q  5 aaacaacctcttgtgt--aaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||| |||||||||||  ||||||||||||||| ||||||||||||||||||||||||||||||||||| || | |||| ||||| ||| |||||||||    
T  8149057 aaactacctcttgtgttaaaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccaga-cttgcgtatgcgagagttttagtgca 8148960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 32 - 115
Target Start/End: Complemental strand, 45019010 - 45018923
Alignment:
Q  32 aagggtgcgtacaatacaccaaa----tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    |||| ||||||||||| ||||||    |||||| |||||||||||||||||||| ||||||||||||||||||||| |||||||||||    
T  45019010 aaggctgcgtacaatataccaaaaaactggtggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgcccttt 45018923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 12 - 115
Target Start/End: Complemental strand, 22699074 - 22698967
Alignment:
Q  12 ctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa--tggtgggacccctt-cccggaccctgcggatgcgggagctttagtgcaccgggt 107  Q
    ||||||||||||||  ||||||||  ||||||||||||||||||  ||||||||||| || ||||||||||| | ||||||||||| |||||||||||||    
T  22699074 ctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaaaatggtgggacccttttcccggaccctgtgtatgcgggagctatagtgcaccgggt 22698975  T
Q  108 tgcccttt 115  Q
    | ||||||    
T  22698974 tacccttt 22698967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 2 - 113
Target Start/End: Original strand, 22065609 - 22065720
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||||||||||||||||||||||||||||||| | ||| ||||||| | ||||| ||| |||||||||||| ||  || | |||| |||| ||||||| |    
T  22065609 tggaaacaacctcttgtgtaaaaatagggtaaagctgcatacaataaagcaaatagtgagaccccttcccgaactatgtgtatgcaggagttttagtgta 22065708  T
Q  102 ccgggttgccct 113  Q
    ||||| ||||||    
T  22065709 ccgggctgccct 22065720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 21139851 - 21139761
Alignment:
Q  12 ctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcac 102  Q
    |||||||||||||| || |||||| ||  |||| ||||||||||||||||||||||||||| || ||| | |||||| |||||||||||||    
T  21139851 ctcttgtgtaaaaacagagtaaggttggatacagtacaccaaatggtgggaccccttcccgaactctgtgtatgcggaagctttagtgcac 21139761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 37 - 106
Target Start/End: Original strand, 21566492 - 21566562
Alignment:
Q  37 tgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccggg 106  Q
    |||||||||||||||||| |||| ||||||||||||| |||||||  ||||||||||||||||||||||||    
T  21566492 tgcgtacaatacaccaaaatggtaggaccccttcccgaaccctgcatatgcgggagctttagtgcaccggg 21566562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 12 - 116
Target Start/End: Original strand, 39123921 - 39124031
Alignment:
Q  12 ctcttgtgtaaaaatagggta----agggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgg 105  Q
    |||||||||||||| ||||||    ||| |||||| |||||||||||  ||||||||||||||||||||||||||| ||| ||||||||| |||||||      
T  39123921 ctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccaa 39124020  T
Q  106 gttgccctttt 116  Q
    | |||||||||    
T  39124021 gctgccctttt 39124031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 40 - 117
Target Start/End: Complemental strand, 23619052 - 23618975
Alignment:
Q  40 gtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttt 117  Q
    |||||||||| ||||||||||||||||||| | |||| ||||  ||| |||||||||||||| |||||||||||||||    
T  23619052 gtacaatacatcaaatggtgggaccccttcgcagaccttgcgtttgcaggagctttagtgcagcgggttgcccttttt 23618975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 29 - 106
Target Start/End: Complemental strand, 28362231 - 28362155
Alignment:
Q  29 ggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccggg 106  Q
    ||||||| ||||||||||||||||||||||||||||||||||| |||| |||  ||| ||||||||| ||||||||||    
T  28362231 ggtaaggctgcgtacaatacaccaaatggtgggaccccttcccagaccttgcatatgtgggagcttt-gtgcaccggg 28362155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 21 - 114
Target Start/End: Complemental strand, 3469271 - 3469176
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctt 114  Q
    ||||| |||||| || ||||||||||||||||||  ||| ||||||||||||  ||||||| | |||||||||||||||||| | |||||||||||    
T  3469271 aaaaacagggtacggttgcgtacaatacaccaaaaatggcgggaccccttcctagaccctgtgtatgcgggagctttagtgcgctgggttgccctt 3469176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 4 - 114
Target Start/End: Original strand, 16341301 - 16341413
Alignment:
Q  4 gaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||||| |||||||||||||||  ||||||||| | |||||||||||||||| ||||||| || |||||||||||   |  ||||||||||||| |||||    
T  16341301 gaaacagcctcttgtgtaaaaaacagggtaaggctacgtacaatacaccaaaatggtgggccctcttcccggacctatcatatgcgggagctttggtgca 16341400  T
Q  102 ccgggttgccctt 114  Q
    ||||| |||||||    
T  16341401 ccgggctgccctt 16341413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 68 - 118
Target Start/End: Original strand, 36602535 - 36602585
Alignment:
Q  68 tcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||| ||||||||| ||||||||||||||||||||||||||||||||||||    
T  36602535 tcccagaccctgcgtatgcgggagctttagtgcaccgggttgccctttttt 36602585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 37 - 105
Target Start/End: Complemental strand, 36267896 - 36267827
Alignment:
Q  37 tgcgtacaatacaccaaatggtgggacccctt-cccggaccctgcggatgcgggagctttagtgcaccgg 105  Q
    |||||||||||||||||||||| |||||| || |||| |||||| | |||||||||||||||||||||||    
T  36267896 tgcgtacaatacaccaaatggttggacccatttcccgaaccctgtgtatgcgggagctttagtgcaccgg 36267827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 14099121 - 14099030
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggag 91  Q
    ||||||| | ||| |||||||||||  ||| ||||  |||||||||||||||||||||||||||||||||||| ||||| || |||| ||||    
T  14099121 ctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctacgtatgcaggag 14099030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 14409138 - 14409047
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggag 91  Q
    ||||||| | ||| |||||||||||  ||| ||||  |||||||||||||||||||||||||||||||||||| ||||| || |||| ||||    
T  14409138 ctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctacgtatgcaggag 14409047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 21 - 96
Target Start/End: Complemental strand, 28078226 - 28078151
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagcttta 96  Q
    ||||| ||||||||| ||| | |||||||||||||||||||||||||||||| | |||||  ||||| ||||||||    
T  28078226 aaaaacagggtaaggttgcatgcaatacaccaaatggtgggaccccttcccgaatcctgcatatgcgagagcttta 28078151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 48123599 - 48123508
Alignment:
Q  1 ctggaaacaacctcttgtgtaaa-aatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggag 91  Q
    ||||||||| ||||||||||||| || |||||||   ||| |||||||||||||||||||||||||||| | ||||| |||  |||||||||    
T  48123599 ctggaaacagcctcttgtgtaaataacagggtaaaactgcatacaatacaccaaatggtgggacccctttctggaccatgcatatgcgggag 48123508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 52 - 122
Target Start/End: Original strand, 45811919 - 45811988
Alignment:
Q  52 aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttttatac 122  Q
    ||||||||||| ||||| || ||||||||  |||| |||||||||||||| ||||||||||||||||||||    
T  45811919 aaatggtgggatccctttccagaccctgcttatgcaggagctttagtgca-cgggttgcccttttttatac 45811988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 41 - 117
Target Start/End: Complemental strand, 13792225 - 13792148
Alignment:
Q  41 tacaatacacc-aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttt 117  Q
    ||||||||||| |||||| ||||||||||| || |||||||| |||| |||||||| |||||||| | ||||||||||    
T  13792225 tacaatacacccaaatggcgggaccccttctcgaaccctgcgtatgctggagcttttgtgcaccgagctgcccttttt 13792148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 52 - 112
Target Start/End: Original strand, 33500587 - 33500645
Alignment:
Q  52 aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccc 112  Q
    |||||||||||||||||||||||||||||| |||||||| ||| ||||  |||||||||||    
T  33500587 aaatggtgggaccccttcccggaccctgcgtatgcgggatcttcagtg--ccgggttgccc 33500645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 44123736 - 44123620
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||| | ||||||| ||| |  ||||||||| ||  |||||||| ||| ||||| ||||| |||| |||||||||  ||    
T  44123736 ctggaaacagcctcttgtgtaaaaacaaggtaaggttgcatgaaatacaccatataatgggacccgttctcggacactgcgtatgcaggagcttta-agc 44123638  T
Q  101 accgggttgccctttttt 118  Q
    | |||| |||||||||||    
T  44123637 aacgggctgccctttttt 44123620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 38 - 118
Target Start/End: Original strand, 25198784 - 25198864
Alignment:
Q  38 gcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||| ||| ||| ||||||| ||| |||||||| |||||| || ||| | |||||||||||||||||||||| |||||||    
T  25198784 gcgtataatgcactaaatggtaggatcccttcccagacccttcgtatgtgagagctttagtgcaccgggttgcactttttt 25198864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 64 - 112
Target Start/End: Complemental strand, 42495913 - 42495865
Alignment:
Q  64 cccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccc 112  Q
    |||||||||||||||||| |||||||||||||||||||||  |||||||    
T  42495913 cccttcccggaccctgcgtatgcgggagctttagtgcaccccgttgccc 42495865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 7644976 - 7645066
Alignment:
Q  1 ctggaaacaacctcttgtgt-aaaaatagggtaagggtgcgtacaatacacc-aaatggtgggaccccttcccggaccctgcggatgcggga 90  Q
    ||||||||| |||||||||| ||||| ||||||||   |||||||||||||| |||| |||||||||||| || ||||||||| ||||||||    
T  7644976 ctggaaacagcctcttgtgtaaaaaacagggtaagatagcgtacaatacaccaaaattgtgggacccctt-cctgaccctgcgtatgcggga 7645066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 37 - 116
Target Start/End: Complemental strand, 23066003 - 23065924
Alignment:
Q  37 tgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    |||||||||||||||| ||| ||||| ||||| ||| | |||||  ||| ||||||||| ||||||||| ||||||||||    
T  23066003 tgcgtacaatacaccatatgatgggatccctttccgaatcctgcatatgtgggagctttggtgcaccggattgccctttt 23065924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 27697457 - 27697572
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacacc-aaatggt--gggacccctt-cccggaccctgcggatgcgggagcttt 95  Q
    |||||||||||||||||||||||||| |||| |||| || ||  |||||||| |||||||  ||||||| || ||| ||||||||| ||||||||||||     
T  27697457 ctggaaacaacctcttgtgtaaaaatcagggcaaggctgtgt--aatacaccaaaatggtgggggaccctttccccagaccctgcgtatgcgggagctta 27697554  T
Q  96 agtgcaccgggttgccct 113  Q
    | ||||||||| ||||||    
T  27697555 aatgcaccgggatgccct 27697572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 27 - 117
Target Start/End: Complemental strand, 39093528 - 39093437
Alignment:
Q  27 agggtaagggtgcgtacaatacacca-aatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttt 117  Q
    ||||||||  || ||||||||||||| ||| |||||| ||||||||||| | |||  |||| | ||||||||||||||||| ||||||||||    
T  39093528 agggtaagactgtgtacaatacaccataatagtgggaacccttcccggaacttgcatatgcagaagctttagtgcaccgggctgcccttttt 39093437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 5 - 115
Target Start/End: Original strand, 6736914 - 6737022
Alignment:
Q  5 aaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccg 104  Q
    |||||||||||||| |||||| | ||||||  ||| |||||||||||||||||| ||| || |||||||||| |||| | |  ||| |||| ||||||||    
T  6736914 aaacaacctcttgtataaaaacaaggtaagactgcatacaatacaccaaatggt-ggagcctttcccggaccttgcgtacgaaggaccttt-gtgcaccg 6737011  T
Q  105 ggttgcccttt 115  Q
    || ||||||||    
T  6737012 ggctgcccttt 6737022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 5 - 54
Target Start/End: Original strand, 12473328 - 12473378
Alignment:
Q  5 aaacaacctcttgtgt-aaaaatagggtaagggtgcgtacaatacaccaaa 54  Q
    |||||||||||||||| ||||| ||||||||| ||||||||||||||||||    
T  12473328 aaacaacctcttgtgtcaaaaacagggtaaggatgcgtacaatacaccaaa 12473378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 84 - 118
Target Start/End: Complemental strand, 44171668 - 44171634
Alignment:
Q  84 tgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||||||||||||||||||||||||||||||    
T  44171668 tgcgggagctttagtgcaccgggttgccctttttt 44171634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 115
Target Start/End: Complemental strand, 14732916 - 14732821
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||| ||||||||| ||||| ||||||||||||  |||||  || |||||||| ||||||   ||||||||||||||||||||||| ||| |||||    
T  14732916 aaaaacagggtaaggctgcgt-caatacaccaaaaatggtgaaactccttcccgaaccctgtttatgcgggagctttagtgcaccggattgtccttt 14732821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 62
Target Start/End: Complemental strand, 23604612 - 23604553
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtggga 62  Q
    |||||||||||||||||||||||| ||||||||  || | |||||||| ||||||||||||    
T  23604612 tggaaacaacctcttgtgtaaaaacagggtaagattgtg-acaatacatcaaatggtggga 23604553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 21 - 99
Target Start/End: Complemental strand, 17048910 - 17048831
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacacc-aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||| ||||||||| | ||||||||||||| ||||||||| ||||||||||||| | |||  |||  ||||||||||||    
T  17048910 aaaaacagggtaaggttacgtacaatacaccaaaatggtggaaccccttcccggaacttgcttatgtaggagctttagtg 17048831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 115
Target Start/End: Original strand, 11888414 - 11888472
Alignment:
Q  57 gtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    |||||||||||| | |||||||| | |||| ||||||| ||||||| ||||||||||||    
T  11888414 gtgggacccctttctggaccctgtgtatgcaggagcttcagtgcactgggttgcccttt 11888472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 71
Target Start/End: Complemental strand, 15108499 - 15108441
Alignment:
Q  13 tcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttccc 71  Q
    ||||||||||||| | ||||||| || |||||||||| ||||| |||||| ||||||||    
T  15108499 tcttgtgtaaaaacaaggtaaggctgtgtacaatacatcaaatagtgggatcccttccc 15108441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 55 - 100
Target Start/End: Complemental strand, 42101944 - 42101899
Alignment:
Q  55 tggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||||| ||||||||||||||| || ||| |||||||||||    
T  42101944 tggtgggaccctttcccggaccctgcgtatccggcagctttagtgc 42101899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 25434112 - 25434144
Alignment:
Q  72 ggaccctgcggatgcgggagctttagtgcaccg 104  Q
    |||||||||| ||||||||||||||||||||||    
T  25434112 ggaccctgcgtatgcgggagctttagtgcaccg 25434144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 87; Significance: 9e-42; HSPs: 88)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 2 - 119
Target Start/End: Complemental strand, 46248067 - 46247949
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    |||||||| |||||||||||||||  ||||||||  ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||     
T  46248067 tggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgt 46247968  T
Q  101 accgggttgccctttttta 119  Q
    |||||||||||||||||||    
T  46247967 accgggttgccctttttta 46247949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 46991847 - 46991966
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||||||||||||||||||  ||||||||| || |||||||||||| ||||||||||||||||||||||||||||| ||| |||||||||||||    
T  46991847 ctggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtg 46991946  T
Q  100 caccgggttgccctttttta 119  Q
    ||||||||||||| ||||||    
T  46991947 caccgggttgcccattttta 46991966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 21 - 115
Target Start/End: Original strand, 4349702 - 4349796
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  4349702 aaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 4349796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 31382328 - 31382211
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||| ||| ||||| |||||||||||||||||||||||||||||||||| |||||||||  |||||||||||||| ||     
T  31382328 ctggaaacagcctcttgtgtaaaaacaggataaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcatatgcgggagctttactgt 31382229  T
Q  101 accgggttgccctttttt 118  Q
    ||||||||||||||||||    
T  31382228 accgggttgccctttttt 31382211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 34725211 - 34725097
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||||||||| |||||||||||||| |||||||||||||||||||||||||||||  ||||||||||| ||||||    
T  34725211 ctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacactaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgc 34725113  T
Q  101 accgggttgccctttt 116  Q
    ||||||||||||||||    
T  34725112 accgggttgccctttt 34725097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 18944686 - 18944807
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagc-ttta 96  Q
    ||||||||| |||||||||||||||  ||||||||| |||||||||||||||||  |||||||||||||||||||||||||||| |||||||||| ||||    
T  18944686 ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaacaatggtgggaccccttcccggaccctgcgtatgcgggagctttta 18944785  T
Q  97 gtgcaccgggttgccctttttt 118  Q
    ||||||||||||||||||||||    
T  18944786 gtgcaccgggttgccctttttt 18944807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 4 - 117
Target Start/End: Complemental strand, 35253297 - 35253185
Alignment:
Q  4 gaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    |||||| ||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| |||||||||    
T  35253297 gaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc 35253199  T
Q  104 gggttgcccttttt 117  Q
    || |||||||||||    
T  35253198 ggattgcccttttt 35253185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 14617081 - 14617197
Alignment:
Q  1 ctggaaacaacctcttgtgtaaa-aatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| ||||||||||||| || | ||||||| |||||||||||||||||||||||||| |||||||||||||||||  |||||||||||||||||    
T  14617081 ctggaaacagcctcttgtgtaaataacaaggtaaggttgcgtacaatacaccaaatggtgggatcccttcccggaccctgcatatgcgggagctttagtg 14617180  T
Q  100 caccgggttgccctttt 116  Q
    ||||||||| |||||||    
T  14617181 caccgggttaccctttt 14617197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 10668268 - 10668386
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||||||||||  | ||||||| |||||||||||||||||  |||||||||||||||||||| ||||||| |||||||||||||||    
T  10668268 ctggaaacagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggtccctgcgtatgcgggagctttag 10668367  T
Q  98 tgcaccgggttgccctttt 116  Q
    |||||||||||||||||||    
T  10668368 tgcaccgggttgccctttt 10668386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 32632671 - 32632556
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||  |||||||  |||||||||||| |||||    
T  32632671 ctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgc 32632572  T
Q  101 accgggttgccctttt 116  Q
    ||| |||| |||||||    
T  32632571 accaggtttccctttt 32632556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 4 - 119
Target Start/End: Complemental strand, 38478392 - 38478278
Alignment:
Q  4 gaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    |||||| ||||||||||||||  ||||||||| |||||||||||||||||||||||| |||||||| ||||||||||  ||||||||||| |||||||||    
T  38478392 gaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtggaaccccttctcggaccctgcatatgcgggagctctagtgcacc 38478294  T
Q  104 gggttgccctttttta 119  Q
    ||||||||||||||||    
T  38478293 gggttgccctttttta 38478278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 6925143 - 6925261
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||| | |||||||||||||| ||||||||||| |||| |||||||||| ||||||||||||||||||||| ||||||| |||||||||||||||||    
T  6925143 ctggaaatagcctcttgtgtaaaaaatagggtaaggctgcggacaatacaccgaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtg 6925242  T
Q  100 caccgggttgccctttttt 118  Q
    ||||| |||||| ||||||    
T  6925243 caccgagttgccttttttt 6925261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 2 - 116
Target Start/End: Original strand, 27474325 - 27474439
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    ||||||||  |||||||||||||| |||| || | ||||||||||||||  ||||||||||||||||||||||||||||| |||||||||||||||||||    
T  27474325 tggaaacagtctcttgtgtaaaaacagggcaaagctgcgtacaatacactgaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca 27474424  T
Q  102 ccgggttgccctttt 116  Q
    |||| ||||||||||    
T  27474425 ccggattgccctttt 27474439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 45402137 - 45402257
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggt--aaggg-tgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| ||||||||||||||| |||||  |||   ||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||    
T  45402137 ctggaaacagcctcttgtgtaaaaacagggttcaagttctgcgtacaatacaccaaatggtgggaccccttcccagaccctgcgtatgcgggagctttag 45402236  T
Q  98 tgcaccgggttgccctttttt 118  Q
    ||||||||||||||| |||||    
T  45402237 tgcaccgggttgcccgttttt 45402257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 4 - 120
Target Start/End: Original strand, 11596559 - 11596674
Alignment:
Q  4 gaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    |||||||||||||||||||||| ||||||||| |||||| ||||||||||||||||||||||||||| |||||||||| ||||||||||||| ||| ||     
T  11596559 gaaacaacctcttgtgtaaaaacagggtaaggctgcgtataatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttt-gtgaaca 11596657  T
Q  104 gggttgcccttttttat 120  Q
    ||| | |||||||||||    
T  11596658 gggcttcccttttttat 11596674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 30395843 - 30395725
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||||||||||  ||||||||| |||||||||||||||||  |||||||||||||||||||||||| ||  |||||||||||||||    
T  30395843 ctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttag 30395744  T
Q  98 tgcaccgggttgccctttt 116  Q
    ||||||| |||||||||||    
T  30395743 tgcaccgagttgccctttt 30395725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 5 - 116
Target Start/End: Original strand, 35005170 - 35005284
Alignment:
Q  5 aaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    ||||| |||||||||||||||  ||||||||| ||| ||||||||||||||  ||||||||||||||||||||||||||| ||||||| |||||||||||    
T  35005170 aaacagcctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggcgctttagtgca 35005269  T
Q  102 ccgggttgccctttt 116  Q
    |||||||||||||||    
T  35005270 ccgggttgccctttt 35005284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 23796508 - 23796626
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| |||||||||||||||| |  |||||| ||||||||||||||||||||||| ||||||||||| ||||||||  |||| ||||||||||||    
T  23796508 ctggaaacagcctcttgtgtaaaaatcaatgtaaggttgcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgctggagctttagtg 23796607  T
Q  100 caccgggttgccctttttt 118  Q
    ||||||| |||||||||||    
T  23796608 caccgggctgccctttttt 23796626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 27201690 - 27201811
Alignment:
Q  1 ctggaaacaacctcttgtgtaa-aaatagggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||||| | ||| ||||||||| ||||||||||||||||||  |||||||||||||||||||||| |||| |||||||||||||||    
T  27201690 ctggaaacagcctcttgtgtcagaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccttgcgtatgcgggagctttag 27201789  T
Q  98 tgcaccgggttgccctttttta 119  Q
    ||||  ||||||||||||||||    
T  27201790 tgcattgggttgccctttttta 27201811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 2 - 110
Target Start/End: Complemental strand, 23768434 - 23768325
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    |||||||| |||||||||||||||  ||||||||| ||||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||||||||||    
T  23768434 tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggacaccttcccagaccctgcgtatgcgggagctttagtgc 23768335  T
Q  101 accgggttgc 110  Q
    | ||| ||||    
T  23768334 agcggattgc 23768325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 12126950 - 12126836
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| | ||||||||||||  ||||||||| ||||||||||||||||||| ||||||||||||||||||||||||  ||||||||||| ||||||    
T  12126950 ctggaaacagcttcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaattgtgggaccccttcccggaccctgcatatgcgggagctgtagtgc 12126852  T
Q  101 accgggttgccctttt 116  Q
    || | |||||||||||    
T  12126851 actgcgttgccctttt 12126836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 22 - 116
Target Start/End: Original strand, 19414502 - 19414596
Alignment:
Q  22 aaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    |||| ||| ||||| |||||||||||||||||||||||||||||||||||| |||||||  ||||||||||| ||||||||||||||||||||||    
T  19414502 aaaacaggttaaggctgcgtacaatacaccaaatggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgccctttt 19414596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 25468378 - 25468285
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagct 93  Q
    |||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| ||||| |||||| ||||||||| |||||||||||    
T  25468378 ctggaaacaacctcttgtgtaaaaatcagggtaaggttgcgtacaatacaccaaatggttggacctcttcccagaccctgcgtatgcgggagct 25468285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 31 - 118
Target Start/End: Complemental strand, 1517395 - 1517308
Alignment:
Q  31 taagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||| ||||||||||||||||| ||||||||||||||| | ||||||||| |||| |||||||||||||||||||||||||||||||    
T  1517395 taaggctgcgtacaatacaccaattggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttgccctttttt 1517308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 21 - 117
Target Start/End: Complemental strand, 18742053 - 18741955
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttt 117  Q
    ||||| ||||||||| ||||||||||||||||||  ||||||||||||||||| ||||||||| ||||| |||||||||||||||||||| ||||||||    
T  18742053 aaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtttcccttttt 18741955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 20004207 - 20004089
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| ||||| |||||||||  | ||||||| |||||||||||||||||  |||||||||||||||||| ||||| ||  |||||||||||||||    
T  20004207 ctggaaacagcctctcgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttag 20004108  T
Q  98 tgcaccgggttgccctttt 116  Q
    |||||||||||||||||||    
T  20004107 tgcaccgggttgccctttt 20004089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 21 - 117
Target Start/End: Complemental strand, 42304303 - 42304205
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttt 117  Q
    ||||| ||||||||| |||||||||||||| |||  ||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||    
T  42304303 aaaaacagggtaaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgcccttttt 42304205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 22 - 112
Target Start/End: Complemental strand, 10378828 - 10378738
Alignment:
Q  22 aaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccc 112  Q
    |||| ||||||||| |||||||||||||||||||||||||||||||||  |||||||||  |||||||||||||||||||||||| |||||    
T  10378828 aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgggctgccc 10378738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 12 - 118
Target Start/End: Complemental strand, 45812639 - 45812534
Alignment:
Q  12 ctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcc 111  Q
    |||||||||||||  ||||||||| ||| |||||||||||||||||||||||||||||||  |||||||  ||||||||||| |||||||||||||||||    
T  45812639 ctcttgtgtaaaag-agggtaaggctgcatacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccgggttgcc 45812541  T
Q  112 ctttttt 118  Q
     ||||||    
T  45812540 ttttttt 45812534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 47214554 - 47214670
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    |||||||||  ||||||| |||||  ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||  ||||||||||| ||||||    
T  47214554 ctggaaacagtctcttgtttaaaac-agggtaaggttgcgtacaatacaccaaatggtgggaccccttcccagaccctgcatatgcgggagctctagtgc 47214652  T
Q  101 accgggttgccctttttt 118  Q
    ||| | || |||||||||    
T  47214653 accagattaccctttttt 47214670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 9939504 - 9939623
Alignment:
Q  1 ctggaaacaacctcttgtgtaa-aaatagggtaagggtgcgtacaatacaccaaa--tggtgggacccc-ttcccggaccctgcggatgcgggagcttta 96  Q
    |||||||||||||||||| ||| ||| | ||||||| ||||| ||||||||||||  |||||||||||| ||| ||||||||||| ||||||||||||||    
T  9939504 ctggaaacaacctcttgtttaagaaacatggtaaggttgcgtgcaatacaccaaaaatggtgggacccccttctcggaccctgcgtatgcgggagcttta 9939603  T
Q  97 gtgcaccgggttgccctttt 116  Q
    |||||||||||| |||||||    
T  9939604 gtgcaccgggttaccctttt 9939623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 41319921 - 41319805
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||  ||||||||||||||  ||||||||| |||||||||||||||||||| ||||||||||||||| ||||| |  ||||||||| || ||||    
T  41319921 ctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatgatgggaccccttcccgaacccttcatatgcgggagtttcagtg 41319822  T
Q  100 caccgggttgccctttt 116  Q
    ||| |||||||||||||    
T  41319821 cactgggttgccctttt 41319805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 2435902 - 2435783
Alignment:
Q  1 ctggaaacaacctcttgtgt-aaaaatagggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||| |||| ||||| ||||||||||||||  |||||||||||||||||| |||||||||||||| ||| ||||| || ||||||||||||||||    
T  2435902 ctggaaacagcctcctgtgtgaaaaatagggtaagcctgcgtacaatacaccaaaatggtgggacccctttccgtaccctccgcatgcgggagctttagt 2435803  T
Q  99 gcaccgggttgccctttttt 118  Q
    |||||||  | |||||||||    
T  2435802 gcaccggactcccctttttt 2435783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 21 - 116
Target Start/End: Complemental strand, 6983905 - 6983810
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    ||||| ||||||||  |||||||||||||||||||||||||||||||| |||||||||||| | || |||||||| |||||||||| |||||||||    
T  6983905 aaaaacagggtaagtatgcgtacaatacaccaaatggtgggacccctttccggaccctgcgtaggcaggagctttggtgcaccgggctgccctttt 6983810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 27 - 118
Target Start/End: Original strand, 43768209 - 43768300
Alignment:
Q  27 agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||||||| ||| ||||||||||||| ||||||||||||||||| ||||||||| || ||||||||||| ||||||||| |||||||||||    
T  43768209 agggtaaggctgcctacaatacaccaattggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgccctttttt 43768300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 44485224 - 44485119
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||||| ||||||||||| | | ||||||| |||||||||||||||||||||| ||||||||||||||| ||| || ||||||||||||| |||    
T  44485224 ctggaaacaaccacttgtgtaaaagacatggtaaggctgcgtacaatacaccaaatggttggaccccttcccggatcctacgtatgcgggagcttt-gtg 44485126  T
Q  100 caccggg 106  Q
    |||||||    
T  44485125 caccggg 44485119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 52 - 118
Target Start/End: Original strand, 50606498 - 50606564
Alignment:
Q  52 aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||    
T  50606498 aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttttt 50606564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 11 - 118
Target Start/End: Original strand, 8197096 - 8197204
Alignment:
Q  11 cctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttg 109  Q
    |||||||||||||||  | ||||||| | |||||| ||||||||||||| |||||||||| ||||||||||| |||  |||||||||||| |||||||||    
T  8197096 cctcttgtgtaaaaaacatggtaaggctacgtacagtacaccaaatggtaggaccccttctcggaccctgcgtatgttggagctttagtgtaccgggttg 8197195  T
Q  110 ccctttttt 118  Q
    |||||||||    
T  8197196 ccctttttt 8197204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 5 - 118
Target Start/End: Original strand, 19701617 - 19701732
Alignment:
Q  5 aaacaacctcttgtgtaaaaatag-ggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcac 102  Q
    ||||| |||||||||||||||    ||||||| || ||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||||||||||||    
T  19701617 aaacagcctcttgtgtaaaaaacttggtaaggatgggtacaatacaccaaaatggtggggccccttcccggaccctgcgtatgcgggagctttagtgcac 19701716  T
Q  103 cgggttgccctttttt 118  Q
    | || | |||||||||    
T  19701717 caggctaccctttttt 19701732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 2 - 116
Target Start/End: Complemental strand, 19974188 - 19974073
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    |||||||| ||||  |||||||||||||| |||| |||||||||||||||||| || |||||||| ||||||||| ||  | ||||||||||||||||||    
T  19974188 tggaaacagcctcaagtgtaaaaatagggcaaggttgcgtacaatacaccaaaatgatgggacccattcccggactctatgtatgcgggagctttagtgc 19974089  T
Q  101 accgggttgccctttt 116  Q
    || ||| |||||||||    
T  19974088 acggggctgccctttt 19974073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 11 - 78
Target Start/End: Complemental strand, 21910753 - 21910686
Alignment:
Q  11 cctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccct 78  Q
    |||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||    
T  21910753 cctcttatgtaaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccct 21910686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 2 - 113
Target Start/End: Original strand, 22324937 - 22325049
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacacc--aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||| ||||||||||||||| ||||||||| ||| |||||||||||  |||||||||  |||| |||| ||||||||| |||||||||||||||||    
T  22324937 tggaaacagcctcttgtgtaaaaacagggtaaggctgcatacaatacaccaaaaatggtggagccccgtccc-gaccctgcgtatgcgggagctttagtg 22325035  T
Q  100 caccgggttgccct 113  Q
    |||| || ||||||    
T  22325036 caccaggctgccct 22325049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 5 - 118
Target Start/End: Original strand, 35019277 - 35019390
Alignment:
Q  5 aaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    |||||||||||||| ||||||| ||  ||||| ||| ||||||||||||| ||||||||||||| ||| ||||||||| ||||| |||||||||||||||    
T  35019277 aaacaacctcttgtataaaaatcagtataaggctgcatacaatacaccaattggtgggacccct-cccagaccctgcgtatgcgagagctttagtgcacc 35019375  T
Q  104 gggttgccctttttt 118  Q
    ||| |||| ||||||    
T  35019376 gggctgccatttttt 35019390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 27 - 104
Target Start/End: Original strand, 15505634 - 15505710
Alignment:
Q  27 agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccg 104  Q
    ||||||||  |||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||    
T  15505634 agggtaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagcttt-gtgcaccg 15505710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 32 - 116
Target Start/End: Complemental strand, 20999933 - 20999849
Alignment:
Q  32 aagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    |||| |||||||||||||||||||| |||| |||||||| | |||||||| | |||||||||||||||||||||| |||||||||    
T  20999933 aaggctgcgtacaatacaccaaatgatggggccccttccggcaccctgcgtacgcgggagctttagtgcaccgggctgccctttt 20999849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 21 - 108
Target Start/End: Complemental strand, 31442484 - 31442396
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggtt 108  Q
    ||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||| ||| | ||| ||||||||| ||||||||||||    
T  31442484 aaaaacagggtaaggatgcgtacaatacaccaaaatggtgggaccccttcccggacactgtgtatgtgggagctttggtgcaccgggtt 31442396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 50811982 - 50812100
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaata--gggtaagggtgcgtacaatacacc-aaatggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| | ||||||||||||| |  |||||||| ||||||||||||||| ||||||| |||||||||||||  ||||||| ||||||||||||||     
T  50811982 ctggaaacagcttcttgtgtaaaaaaacagggtaaggttgcgtacaatacaccaaaatggt-ggaccccttcccgcgccctgcgtatgcgggagctttaa 50812080  T
Q  98 tgcaccgggttgcccttttt 117  Q
    ||||| ||| ||||||||||    
T  50812081 tgcactgggctgcccttttt 50812100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 18724660 - 18724565
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagcttt 95  Q
    ||||||||| |||||||||||||||  ||||||||| || ||||||||||||||||  ||||||||||||||||||||| |  |||||||||||||    
T  18724660 ctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaaatcttgggaccccttcccggaccctacatatgcgggagcttt 18724565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 21 - 113
Target Start/End: Complemental strand, 19932849 - 19932755
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccct 113  Q
    ||||| ||||||||| ||||||||||||||||||  ||||||||||||||||||||||||||| ||||  || | |||||||||| |||||||||    
T  19932849 aaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcaccaggttgccct 19932755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 20036263 - 20036380
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaata--gggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    |||||||||| |||||||||||| | |  |||||||  ||||| |||||||||||||||||| |||||||||||||||||||| |||| |||| ||| ||    
T  20036263 ctggaaacaaactcttgtgtaaagagaaagggtaagattgcgttcaatacaccaaatggtggaaccccttcccggaccctgcgtatgcaggag-ttttgt 20036361  T
Q  99 gcaccgggttgcccttttt 117  Q
    |||||||| ||| ||||||    
T  20036362 gcaccgggctgctcttttt 20036380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 35117883 - 35117765
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcg-gatgcgggagcttta 96  Q
    ||||||| | |||||||||||||| | ||||||||| || |||||||||||||||  || ||||||||||||||||||||||||  |||| |||||||||    
T  35117883 ctggaaatagcctcttgtgtaaaatacagggtaaggctgtgtacaatacaccaaaaatgatgggaccccttcccggaccctgcgtaatgcaggagcttta 35117784  T
Q  97 gtgcaccgggttgcccttt 115  Q
    |||||||||| | ||||||    
T  35117783 gtgcaccgggcttcccttt 35117765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 48 - 110
Target Start/End: Complemental strand, 4587630 - 4587568
Alignment:
Q  48 caccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgc 110  Q
    |||||||||||||||||||||||||||||||||  |||||||||||| |||||||||||||||    
T  4587630 caccaaatggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccgggttgc 4587568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 31272489 - 31272378
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||||||||||||||||||| | ||||||| ||||||||  ||| |||||||||||      | |||||||||||| |||||||||||||||||     
T  31272489 ctggaaacaacctcttgtgtaaaaacatggtaaggctgcgtacagcacatcaaatggtggg------ttccggaccctgcgtatgcgggagctttagtgg 31272396  T
Q  101 accgggttgccctttttt 118  Q
    || ||| |||||||||||    
T  31272395 actgggctgccctttttt 31272378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 34149075 - 34148969
Alignment:
Q  1 ctggaaacaacctcttgtgta-aaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| ||||||||||| |||||||||||||| ||||||||| | ||||||||||| |||||||||| |||||||||  |||| |||||  |||||    
T  34149075 ctggaaacagcctcttgtgtagaaaatagggtaaggttgcgtacaaaagaccaaatggtgagaccccttcctggaccctgcatatgcaggagcgctagtg 34148976  T
Q  100 caccggg 106  Q
    || ||||    
T  34148975 caacggg 34148969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 15511266 - 15511150
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcg--tacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagcttta 96  Q
    ||||||||  |||||||||||||||  ||||||||| ||||  |||||||||||||| |||||| ||||||||| |||||||||| ||| | ||||||||    
T  15511266 ctggaaaccgcctcttgtgtaaaaaacagggtaaggctgcggatacaatacaccaaaatggtggtaccccttcctggaccctgcgtatgtgtgagcttta 15511167  T
Q  97 gtgcaccgggttgccct 113  Q
    |||||||||| ||||||    
T  15511166 gtgcaccgggctgccct 15511150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 39215074 - 39214961
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaata-gggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    |||||||||||||||||||||||||   |||||||| |||||||||||  ||||| ||||||| |||||||||  |||||||| ||| || |||||||||    
T  39215074 ctggaaacaacctcttgtgtaaaaaactgggtaaggctgcgtacaatattccaaaatggtgggtccccttcccaaaccctgcgtatgtggaagctttagt 39214975  T
Q  99 gcaccgggttgccc 112  Q
    |||||||| |||||    
T  39214974 gcaccgggctgccc 39214961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 45264515 - 45264411
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||||||||||||| |||||  || |||||| || || |||||||||||| ||||||||||||||| | ||||||||  ||||||||||||||||    
T  45264515 ctggaaacaacctcttgtgcaaaaaacagagtaaggctgtgtgcaatacaccaaaatggtgggaccccttctcagaccctgcatatgcgggagctttagt 45264416  T
Q  99 gcacc 103  Q
    |||||    
T  45264415 gcacc 45264411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 2 - 81
Target Start/End: Original strand, 21723728 - 21723807
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcg 81  Q
    |||||||| |||||||| |||||||||||||||| || ||||||||||||||||||| | |||  |||||||||||||||    
T  21723728 tggaaacagcctcttgtataaaaatagggtaaggctgagtacaatacaccaaatggtagaaccttttcccggaccctgcg 21723807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 22930182 - 22930104
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgc 80  Q
    ||||||||| ||| ||||||||||| ||||||||| || | ||||||||||||||||||||||||||||| |||||||||    
T  22930182 ctggaaacagccttttgtgtaaaaacagggtaaggttgtg-acaatacaccaaatggtgggaccccttcctggaccctgc 22930104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 52 - 118
Target Start/End: Original strand, 30555210 - 30555276
Alignment:
Q  52 aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||||||||||||| ||||||||||| ||||| |||||||||||||||||| || ||||||||    
T  30555210 aaatggtgggaccccttcacggaccctgcgtatgcgagagctttagtgcaccgggctgacctttttt 30555276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 2 - 117
Target Start/End: Original strand, 24564388 - 24564494
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||||||||||||||||||  |||||||||||||||||||| |||||||||||       |||   |||||||||  |||| ||||| |||||||    
T  24564388 tggaaacaacctcttgtgtaaaaaacagggtaagggtgcgtacaattcaccaaatggt-------ctt---ggaccctgcctatgcaggagcgttagtgc 24564477  T
Q  101 accgggttgcccttttt 117  Q
    |||||||||||||||||    
T  24564478 accgggttgcccttttt 24564494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 11 - 95
Target Start/End: Original strand, 30682867 - 30682950
Alignment:
Q  11 cctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagcttt 95  Q
    ||||||||||||||| | ||||||  || ||||| |||| |||||||||||||||||||||||||| |||| |||||||||||||    
T  30682867 cctcttgtgtaaaaacaaggtaagattgtgtaca-tacaacaaatggtgggaccccttcccggaccgtgcgtatgcgggagcttt 30682950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 4 - 106
Target Start/End: Original strand, 23371170 - 23371271
Alignment:
Q  4 gaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    |||||| || |||| |||||||  ||| |||| || ||||||||||||||||| ||||||||||| || ||||||||| ||| || ||||||||||||||    
T  23371170 gaaacagccacttgggtaaaaaacgggcaaggttgtgtacaatacaccaaatgctgggacccctt-ccagaccctgcgtatgtggtagctttagtgcacc 23371268  T
Q  104 ggg 106  Q
    |||    
T  23371269 ggg 23371271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 27136767 - 27136661
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacacc-aaatggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    |||| ||||||||||||||||||||  | ||||||| ||||||||||||||| |||||||||||||||||||  || | || | |||||||||||  |||    
T  27136767 ctgggaacaacctcttgtgtaaaaaacatggtaaggttgcgtacaatacaccaaaatggtgggaccccttcctagatcatgtgtatgcgggagctccagt 27136668  T
Q  99 gcaccgg 105  Q
    |||||||    
T  27136667 gcaccgg 27136661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 50 - 116
Target Start/End: Complemental strand, 33594196 - 33594130
Alignment:
Q  50 ccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    |||| ||||||||||||||||| ||||||||| |||||||||||||||||||| ||| | |||||||    
T  33594196 ccaattggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcactgggctaccctttt 33594130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 38 - 103
Target Start/End: Complemental strand, 4249520 - 4249455
Alignment:
Q  38 gcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    ||||||||||||||||||||||||| ||||||||| ||| || | |||||||||||||| ||||||    
T  4249520 gcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttaatgcacc 4249455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 38 - 103
Target Start/End: Complemental strand, 4249844 - 4249779
Alignment:
Q  38 gcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    ||||||||||||||||||||||||| ||||||||| ||| || | |||||||||||||| ||||||    
T  4249844 gcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttaatgcacc 4249779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 38 - 103
Target Start/End: Complemental strand, 4250168 - 4250103
Alignment:
Q  38 gcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    ||||||||||||||||||||||||| ||||||||| ||| || | |||||||||||||| ||||||    
T  4250168 gcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttaatgcacc 4250103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 2 - 66
Target Start/End: Original strand, 33223028 - 33223093
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacacc-aaatggtgggacccc 66  Q
    |||||||| ||||||||||||||| |||| |||| ||||||||||||||| |||||||||||||||    
T  33223028 tggaaacagcctcttgtgtaaaaacagggaaaggttgcgtacaatacaccaaaatggtgggacccc 33223093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 37 - 100
Target Start/End: Complemental strand, 4430077 - 4430014
Alignment:
Q  37 tgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    |||||||||||||||||||||||| ||||||| | ||| |||| | ||||||||||||||||||    
T  4430077 tgcgtacaatacaccaaatggtggaacccctttctggatcctgtgtatgcgggagctttagtgc 4430014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 27 - 117
Target Start/End: Original strand, 6358191 - 6358282
Alignment:
Q  27 agggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttt 117  Q
    ||||||| | ||||||||| |||||||| ||||||||||||||||| ||||||||| |||| ||| ||||||||  | ||| ||||||||||    
T  6358191 agggtaaagctgcgtacaaaacaccaaaatggtgggaccccttcccagaccctgcgtatgcaggatctttagtgatcggggctgcccttttt 6358282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 21 - 92
Target Start/End: Complemental strand, 20982844 - 20982773
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagc 92  Q
    ||||||||||||||| |||  |||||||||| |||||||||| | |||| ||||||||||| ||||||||||    
T  20982844 aaaaatagggtaaggctgccaacaatacacctaatggtgggatctcttctcggaccctgcgtatgcgggagc 20982773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 2 - 118
Target Start/End: Original strand, 43207539 - 43207657
Alignment:
Q  2 tggaaacaacctcttgtgt-aaaaatagggtaagggtgcgtacaatacaccaaat-ggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||||||||| ||| ||||| ||||||||   || ||||||||||||||| ||||||||| |||||| ||||||  | ||||| |||||||||||    
T  43207539 tggaaacaacctcttatgtgaaaaacagggtaagacggcatacaatacaccaaattggtgggacctcttcccagaccctatgtatgcgagagctttagtg 43207638  T
Q  100 caccgggttgccctttttt 118  Q
    ||  || ||||| ||||||    
T  43207639 cattggtttgccatttttt 43207657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 34679331 - 34679217
Alignment:
Q  4 gaaacaacctcttgtgta-aaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggac----cctgcggatgcgggagctttagt 98  Q
    |||||||||||||||||| |||| ||||||||  ||||||| ||||| ||||||||||  |||| | || |||    |||||| ||||||||||||||||    
T  34679331 gaaacaacctcttgtgtaaaaaacagggtaagactgcgtactatacatcaaatggtggagccccgttccagacccggcctgcgtatgcgggagctttagt 34679232  T
Q  99 gcaccgggttgccct 113  Q
     ||||||| ||||||    
T  34679231 acaccgggctgccct 34679217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 4 - 101
Target Start/End: Complemental strand, 17470458 - 17470361
Alignment:
Q  4 gaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacacc-aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||||| |||||||||||||||  ||||||||| ||||||||||||||| |||| ||||||||| |||| |   |||||| ||| |||||||||||||||    
T  17470458 gaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatagtgggacccgttcctg--acctgcgtatgtgggagctttagtgca 17470361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 5 - 95
Target Start/End: Complemental strand, 20169200 - 20169109
Alignment:
Q  5 aaacaacctcttgtgtaaaaatag-ggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagcttt 95  Q
    ||||| ||||||||||||||| |  ||||||  || ||||||||| ||||  |||||||| ||||||||||||||||  |||||||||||||    
T  20169200 aaacaccctcttgtgtaaaaaaaaaggtaagactgtgtacaataccccaatcggtgggactccttcccggaccctgcatatgcgggagcttt 20169109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 18335403 - 18335305
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    |||||||||  ||||||| ||||||| ||||||| | ||||||||||||| |||||| |||||||| ||||  |||| || | || |||||||||||||    
T  18335403 ctggaaacagtctcttgtttaaaaattagggtaaagttgcgtacaatacatcaaatgatgggaccctttcctagaccatgtgtatacgggagctttagt 18335305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 61 - 115
Target Start/End: Complemental strand, 25554796 - 25554742
Alignment:
Q  61 gaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    |||||||||||| |||||||| |||||||||| ||||||||||||  ||||||||    
T  25554796 gaccccttcccgaaccctgcgtatgcgggagcattagtgcaccggactgcccttt 25554742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 60 - 117
Target Start/End: Original strand, 16120819 - 16120876
Alignment:
Q  60 ggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttt 117  Q
    |||||||||||||| ||||||  |||||||||||||| |||||| || ||||||||||    
T  16120819 ggaccccttcccggcccctgcatatgcgggagctttaatgcaccaggctgcccttttt 16120876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 31 - 112
Target Start/End: Complemental strand, 28894642 - 28894561
Alignment:
Q  31 taagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccc 112  Q
    ||||| ||||||||||||| ||||||||   |||||||||  ||||||||  ||||| ||||||||||||||| || |||||    
T  28894642 taaggttgcgtacaatacatcaaatggtaaaaccccttcctagaccctgcatatgcgagagctttagtgcaccaggctgccc 28894561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 68 - 117
Target Start/End: Complemental strand, 50760287 - 50760238
Alignment:
Q  68 tcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttt 117  Q
    ||||| |||||||| |||||||||||||| ||||||||| ||||||||||    
T  50760287 tcccgaaccctgcgtatgcgggagctttaatgcaccgggctgcccttttt 50760238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 118
Target Start/End: Complemental strand, 43921866 - 43921787
Alignment:
Q  41 tacaatacaccaaatggtgggacccc--ttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||||||||||||| |||||||  ||| ||||||||||  ||||| |||||||||||||  ||  |||||||||||    
T  43921866 tacaatacaccaaatggtaggacccctattctcggaccctgcacatgcgagagctttagtgcattggactgccctttttt 43921787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 56 - 115
Target Start/End: Original strand, 37299573 - 37299632
Alignment:
Q  56 ggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||||||||||||||||||| || | ||||| ||||||||||||||  || ||||||||    
T  37299573 ggtgggaccccttcccggaccatgtgcatgcgagagctttagtgcactaggctgcccttt 37299632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 118
Target Start/End: Complemental strand, 41440665 - 41440599
Alignment:
Q  52 aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||||||| |||||||||  ||| ||| | ||||||||||||||||| |||||  |||||||||||    
T  41440665 aaatggtggaaccccttcctagactctgtgtatgcgggagctttagtgaaccggactgccctttttt 41440599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 118
Target Start/End: Original strand, 46859130 - 46859228
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacacc-aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||| ||||||||  ||||||||||||||| |||||||||||| | ||  | | || |||| ||| ||||| |||||||||||||| | |||||||||    
T  46859130 aaaaacagggtaagactgcgtacaatacaccaaaatggtgggactcattttcaggccttgcgtatgtgggagttttagtgcaccgggcttccctttttt 46859228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 61
Target Start/End: Complemental strand, 4430129 - 4430080
Alignment:
Q  13 tcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtggg 61  Q
    |||||||||||||  ||||||||  |||||||||||||||||||||||||    
T  4430129 tcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtggg 4430080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 52 - 103
Target Start/End: Original strand, 1693221 - 1693273
Alignment:
Q  52 aaatggtgggaccccttcccggaccctgcggatgcgggagc-tttagtgcacc 103  Q
    |||||||||||||||||||| ||||| || ||||| ||||| |||||||||||    
T  1693221 aaatggtgggaccccttcccagacccggcagatgcaggagcttttagtgcacc 1693273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 39 - 99
Target Start/End: Original strand, 10158281 - 10158341
Alignment:
Q  39 cgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||||||||||||||| ||||||| | ||| | |||| || || |||||||||||    
T  10158281 cgtacaatacaccaaatggtggcacccctttcaggatcatgcgtatacgagagctttagtg 10158341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 85; Significance: 1e-40; HSPs: 51)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 29355972 - 29355853
Alignment:
Q  1 ctggaaacaacctcttgtgtaa-aaatagggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||||||| ||| ||||||||| |||||||||||||||||  |||||||||||||||||||||||||||| |||||||||||||||    
T  29355972 ctggaaacagcctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttag 29355873  T
Q  98 tgcaccgggttgcccttttt 117  Q
    ||||||||||||||||||||    
T  29355872 tgcaccgggttgcccttttt 29355853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 1354870 - 1354756
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| ||||||    
T  1354870 ctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgc 1354772  T
Q  101 accgggttgccctttt 116  Q
    ||||||||||||||||    
T  1354771 accgggttgccctttt 1354756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 1346984 - 1347100
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| || |||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| ||||||    
T  1346984 ctggaaacagccacttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgc 1347082  T
Q  101 accgggttgccctttttt 118  Q
    ||||||||||||||||||    
T  1347083 accgggttgccctttttt 1347100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 26097180 - 26097295
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||||||||| ||||||||||||||||||||  ||||||||||||||||||||||  ||||||||||| ||||||    
T  26097180 ctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatgaagggaccccttcccggaccctgcatatgcgggagctctagtgc 26097278  T
Q  101 accgggttgcccttttt 117  Q
    |||||||||||||||||    
T  26097279 accgggttgcccttttt 26097295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 2 - 116
Target Start/End: Complemental strand, 12222031 - 12221913
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagc-tttag 97  Q
    |||||||| |||||||||||||||  ||||||||| |||||||||||||||||  |||||||||||||||||||||||||||| |||||||||| |||||    
T  12222031 tggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagcttttag 12221932  T
Q  98 tgcaccgggttgccctttt 116  Q
    |||||||||||||||||||    
T  12221931 tgcaccgggttgccctttt 12221913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 9161143 - 9161262
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||| ||||||||||||||| || |||||| ||||||||||||| |||  |||||||||||||||| ||||||||||| |||||| |||||||||    
T  9161143 ctggaaacagcctcttgtgtaaaaacagagtaaggctgcgtacaatacatcaataatggtgggaccccttctcggaccctgcgtatgcggaagctttagt 9161242  T
Q  99 gcaccgggttgccctttttt 118  Q
    ||||| ||||||||||||||    
T  9161243 gcaccaggttgccctttttt 9161262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 25557745 - 25557860
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||||||||| ||||||||||||||||||||  || |||||||||||||||||||  ||||||||||| ||||||    
T  25557745 ctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatgaaggaaccccttcccggaccctgcatatgcgggagctctagtgc 25557843  T
Q  101 accgggttgcccttttt 117  Q
    |||||||||||||||||    
T  25557844 accgggttgcccttttt 25557860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 2166527 - 2166406
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    |||||||||||||||||||||||| | ||| ||||| |||||||||||||||||  |||||||||||||||||||||||||    || ||||||||||||    
T  2166527 ctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttag 2166428  T
Q  98 tgcaccgggttgccctttttta 119  Q
    ||||||||||||||||||||||    
T  2166427 tgcaccgggttgccctttttta 2166406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 2178160 - 2178039
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    |||||||||||||||||||||||| | ||| ||||| |||||||||||||||||  |||||||||||||||||||||||||    || ||||||||||||    
T  2178160 ctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttag 2178061  T
Q  98 tgcaccgggttgccctttttta 119  Q
    ||||||||||||||||||||||    
T  2178060 tgcaccgggttgccctttttta 2178039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 2 - 125
Target Start/End: Complemental strand, 18277307 - 18277183
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    |||||||| |||||||||||||||| ||||||||| || |||||  ||||||||||||||||||||||||  ||| || || |||||||||||||| |||    
T  18277307 tggaaacagcctcttgtgtaaaaatcagggtaaggttgagtacagaacaccaaatggtgggaccccttcctagactctacgtatgcgggagctttactgc 18277208  T
Q  101 accgggttgcccttttttatacaat 125  Q
    ||||||||| |||||||| ||||||    
T  18277207 accgggttgtccttttttttacaat 18277183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 43 - 117
Target Start/End: Original strand, 13267788 - 13267862
Alignment:
Q  43 caatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttt 117  Q
    |||||||||||||||||||||||||||| |||||||||| |||||||||||| ||||||||||||||||||||||    
T  13267788 caatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgcccttttt 13267862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 7947487 - 7947371
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    |||||||||||||| ||||||||||  ||||||||| |||||||||||||||||| ||||||| |||||||||||||| |||| ||| ||||||||||||    
T  7947487 ctggaaacaacctcctgtgtaaaaaccagggtaaggctgcgtacaatacaccaaaatggtgggcccccttcccggaccttgcgtatgtgggagctttagt 7947388  T
Q  99 gcaccgggttgcccttt 115  Q
    ||||  || ||||||||    
T  7947387 gcacttggctgcccttt 7947371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 37 - 116
Target Start/End: Complemental strand, 23930205 - 23930126
Alignment:
Q  37 tgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    |||||||||||||||| |||||||||||||||| ||||||||||  |||||||||||||||||||||| |||||||||||    
T  23930205 tgcgtacaatacaccagatggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgccctttt 23930126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 5 - 118
Target Start/End: Original strand, 1941879 - 1941993
Alignment:
Q  5 aaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    |||||||||||||||||||||  ||||||||| ||||||||||||||| |||||||||||||| ||| ||| | || | ||||||||| ||| |||||||    
T  1941879 aaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccatcctggatcttgtgtatgcgggagtttttgtgcacc 1941978  T
Q  104 gggttgccctttttt 118  Q
    | |||||||||||||    
T  1941979 gtgttgccctttttt 1941993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 32579446 - 32579543
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagt 98  Q
    ||||||||| ||||| || |||||||| ||||||  |||||||||||| |||||||||||||||||||||| ||||||||  ||||||||||||||||    
T  32579446 ctggaaacagcctctggtataaaaatacggtaagcctgcgtacaataccccaaatggtgggaccccttcccagaccctgcatatgcgggagctttagt 32579543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 53 - 117
Target Start/End: Original strand, 6808468 - 6808532
Alignment:
Q  53 aatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttt 117  Q
    ||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||    
T  6808468 aatggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttttt 6808532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 37 - 118
Target Start/End: Original strand, 12892064 - 12892147
Alignment:
Q  37 tgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||| ||||||||||  |||||||||||||||||||||||| ||  ||||||||||||||||||||||||||||||||||||    
T  12892064 tgcgtataatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttttt 12892147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 37 - 116
Target Start/End: Original strand, 12885968 - 12886049
Alignment:
Q  37 tgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttt 116  Q
    |||||||||||||| |||  ||||||||||||||||| ||||||||| ||| ||||||||||||||||||||||||||||||    
T  12885968 tgcgtacaatacacaaaaaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgccctttt 12886049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 38 - 115
Target Start/End: Complemental strand, 383837 - 383760
Alignment:
Q  38 gcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    |||||||||||||||||| ||||||||||||| | ||||||||| |||||||||||| ||| ||||||||||||||||    
T  383837 gcgtacaatacaccaaattgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgcccttt 383760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 3815192 - 3815084
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaa-tagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||  || ||||||||||| || |||| |  ||||||||||||||||||||||||||||| |||||| ||||| || |||||| ||||||||||    
T  3815192 ctggaaacagactattgtgtaaaaaatatggtacgactgcgtacaatacaccaaatggtgggaccctttcccgaaccctacgtatgcggaagctttagtg 3815093  T
Q  100 caccgggtt 108  Q
    |||||||||    
T  3815092 caccgggtt 3815084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 23240937 - 23240826
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||||||||  ||||||||||| ||||| |||||||||||||||  ||||  |||| ||||||||||||||||||    
T  23240937 ctggaaacagcctcttgtgtaaaac-agggtaagtttgcgtacaatataccaattggtgggaccccttctaggacaatgcgtatgcgggagctttagtgc 23240839  T
Q  101 accgggttgccct 113  Q
    || ||| ||||||    
T  23240838 actgggctgccct 23240826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 33138853 - 33138957
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||||||||||| ||||||  || ||||||  |||||||||||||||||||||||||||| || |||||||||| | |||| | ||||||||||    
T  33138853 ctggaaacaacctcttgtataaaaaacagagtaaggccgcgtacaatacaccaaatggtgggacccttttccggaccctgtgtatgcagtagctttagtg 33138952  T
Q  100 caccg 104  Q
    |||||    
T  33138953 caccg 33138957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 49 - 119
Target Start/End: Original strand, 24097646 - 24097716
Alignment:
Q  49 accaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttta 119  Q
    ||||||||||||||||||||||||||||||||| |||||| ||||||||||  || |||||||||||||||    
T  24097646 accaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgtcccaggttgccctttttta 24097716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 37 - 118
Target Start/End: Complemental strand, 3116209 - 3116126
Alignment:
Q  37 tgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||| |||||||||||||  ||||||||||||||| |||||| |||| |||||||||||||||| |||||| ||||||||||||    
T  3116209 tgcgcacaatacaccaaaaatggtgggaccccttctcggaccttgcgtatgcgggagctttagtacaccggattgccctttttt 3116126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 15866152 - 15866041
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||||| ||||||  |||||||  ||||||| | ||||||  |||||||||||||||||||||||||||||||||||||  ||||||| || |||||    
T  15866152 ctggaaacagcctcttaagtaaaaaacagggtaaagctgcgta--atacaccaaatggtgggaccccttcccggaccctgcgtttgcgggatctatagtg 15866055  T
Q  100 caccgggttgccct 113  Q
    ||| | ||||||||    
T  15866054 cactgagttgccct 15866041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 47 - 115
Target Start/End: Complemental strand, 10734974 - 10734905
Alignment:
Q  47 acaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    |||||||| ||||||| ||||||||||||||||||| |||||||||||||||| ||||||| ||||||||    
T  10734974 acaccaaagtggtgggcccccttcccggaccctgcgtatgcgggagctttagtccaccgggctgcccttt 10734905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 27 - 115
Target Start/End: Original strand, 17432393 - 17432483
Alignment:
Q  27 agggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||||||| || ||||||||||| |||  ||||| ||||  |||||||| |||| | |||||||||||||||||||||||||||||||||    
T  17432393 agggtaaggctgtgtacaatacactaaaaatggtgagaccttttcccggatcctgtgcatgcgggagctttagtgcaccgggttgcccttt 17432483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 2 - 91
Target Start/End: Original strand, 22967192 - 22967287
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtaca------atacaccaaatggtgggaccccttcccggaccctgcggatgcgggag 91  Q
    |||||||||| ||||||||||||||||| ||||| ||| ||||      |||||||||||||||||||||||||  |||||||||  |||||||||    
T  22967192 tggaaacaacttcttgtgtaaaaataggataaggctgcatacaaatacaatacaccaaatggtgggaccccttcttggaccctgcctatgcgggag 22967287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 2 - 91
Target Start/End: Complemental strand, 23821201 - 23821106
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaa------tacaccaaatggtgggaccccttcccggaccctgcggatgcgggag 91  Q
    |||||||||| ||||||||||||||||| ||||| ||| |||||      ||||||||||||||||||||||||  |||||||||  |||||||||    
T  23821201 tggaaacaacttcttgtgtaaaaataggataaggctgcatacaaatacaatacaccaaatggtgggaccccttcttggaccctgcctatgcgggag 23821106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 62 - 118
Target Start/End: Complemental strand, 30786427 - 30786371
Alignment:
Q  62 accccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    ||||||||| ||||| |||| ||||||||||||||||||||||||||||| ||||||    
T  30786427 accccttcctggaccgtgcgtatgcgggagctttagtgcaccgggttgccttttttt 30786371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 47 - 105
Target Start/End: Original strand, 11395827 - 11395886
Alignment:
Q  47 acaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgg 105  Q
    |||||||| |||||||||||||||||||| |||||| |||||||||||||||| ||||||    
T  11395827 acaccaaagtggtgggaccccttcccggatcctgcgtatgcgggagctttagtccaccgg 11395886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 43 - 111
Target Start/End: Complemental strand, 14975164 - 14975094
Alignment:
Q  43 caatacaccaa--atggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcc 111  Q
    |||||||||||  ||||||||||||||||||| |||| ||  ||||||||| |||||||||||||||||||    
T  14975164 caatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagttttagtgcaccgggttgcc 14975094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 28007648 - 28007761
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||| | ||||||||||||||  ||||| ||| |||||||||||||||||||| ||||||||||||||  | ||| |  |||||| |||| ||||||    
T  28007648 ctggaaagagcctcttgtgtaaaac-agggtcaggctgcgtacaatacaccaaatgctgggaccccttccc-taacctccatatgcggaagctctagtgc 28007745  T
Q  101 accgggttgccctttt 116  Q
    ||||| || |||||||    
T  28007746 accggattaccctttt 28007761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 2 - 116
Target Start/End: Complemental strand, 32728270 - 32728156
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||||||||| ||||||||  ||||||||  || |||||||| ||||||| ||||  ||| ||||| |||||| || |||||||| |||||||||    
T  32728270 tggaaacaacctcttatgtaaaaaacagggtaagactgtgtacaatataccaaatagtggt-ccctttcccagaccctacgtatgcgggaactttagtgc 32728172  T
Q  101 accgggttgccctttt 116  Q
    |||  |||||||||||    
T  32728171 accatgttgccctttt 32728156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 44 - 113
Target Start/End: Complemental strand, 15865928 - 15865859
Alignment:
Q  44 aatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccct 113  Q
    ||||||||||||||||||||||||||| ||||||||||  |||| || || |||||||| | ||||||||    
T  15865928 aatacaccaaatggtgggaccccttcctggaccctgcgtttgcgtgatctatagtgcactgagttgccct 15865859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 11 - 106
Target Start/End: Original strand, 19340858 - 19340954
Alignment:
Q  11 cctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccggg 106  Q
    |||||||||||||||  ||||||||| |||  ||||||||||||| || ||||||||||||| |||||| ||| |||||| |||||||||||| ||||    
T  19340858 cctcttgtgtaaaaaacagggtaaggttgca-acaatacaccaaaatgatgggaccccttcctggacccggcgtatgcggaagctttagtgcaacggg 19340954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 21 - 117
Target Start/End: Original strand, 12228399 - 12228495
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttt 117  Q
    ||||||||| ||| | |||||||||||||||| || |||||||||||||||  | ||| || | | ||||| ||||||| || ||||||||||||||    
T  12228399 aaaaataggataaagttgcgtacaatacaccagatagtgggaccccttcccataacctacgtaagtgggagttttagtgtactgggttgcccttttt 12228495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 5 - 115
Target Start/End: Original strand, 12889450 - 12889562
Alignment:
Q  5 aaacaacctcttgtgt-aaaaatagggtaagggtgcgtacaatacacc-aaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcac 102  Q
    ||||| |||||||||| ||||| |||| |||| ||| ||||||||||| ||| | ||||||||||| |||||||||  |  || |||||||||||||||     
T  12889450 aaacagcctcttgtgttaaaaacagggcaaggctgcatacaatacacctaaacgatgggacccctttccggaccctctgtgtgtgggagctttagtgcat 12889549  T
Q  103 cgggttgcccttt 115  Q
    |||| ||||||||    
T  12889550 cgggctgcccttt 12889562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 5 - 112
Target Start/End: Complemental strand, 13905090 - 13904984
Alignment:
Q  5 aaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    |||| ||||||||||||||||  ||||||||| ||| |||||| ||||||||||| |||||| |||||| |||||||| ||   |||||||| |||||||    
T  13905090 aaacgacctcttgtgtaaaaaacagggtaaggctgcatacaattcaccaaatggt-ggaccctttcccgaaccctgcgtatcacggagcttt-gtgcacc 13904993  T
Q  104 gggttgccc 112  Q
    ||| |||||    
T  13904992 gggctgccc 13904984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 5 - 118
Target Start/End: Complemental strand, 9671196 - 9671081
Alignment:
Q  5 aaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtgcac 102  Q
    ||||| |||||||||||||||  ||||||||| ||| |||  |||| |||| |||| ||||||||| ||| |||||||  || ||||||||||| ||||     
T  9671196 aaacagcctcttgtgtaaaaaacagggtaaggctgcctactttacatcaaaatggtaggacccctttccgaaccctgcaaatacgggagctttaatgcat 9671097  T
Q  103 cgggttgccctttttt 118  Q
    |||| |||||||||||    
T  9671096 cgggctgccctttttt 9671081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 21 - 97
Target Start/End: Original strand, 24734683 - 24734760
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacaccaaat--ggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||| ||||||||| ||||||||||||| ||||   ||||||||||||||||||| |||||| |||| ||||||||||    
T  24734683 aaaaacagggtaaggttgcgtacaatacaacaaaaaaggtgggaccccttcccggatcctgcgtatgc-ggagctttag 24734760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 3 - 99
Target Start/End: Original strand, 11849075 - 11849173
Alignment:
Q  3 ggaaacaacctcttgtgt-aaaaatagggtaagggtgcgtacaatacaccaaa-tggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    |||||||||||||||||| ||||| ||| ||| | |||  ||||||||||||| |||||||||||||||||| || ||||| ||| | || ||||||||    
T  11849075 ggaaacaacctcttgtgttaaaaacaggataaagttgcccacaatacaccaaaatggtgggaccccttcccgaactctgcgtatgtgagatctttagtg 11849173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 56 - 117
Target Start/End: Complemental strand, 33922916 - 33922855
Alignment:
Q  56 ggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttttt 117  Q
    ||||| |||||||||||||||||||  |||  |||||||||||||||  |||||||||||||    
T  33922916 ggtggcaccccttcccggaccctgcttatgttggagctttagtgcacatggttgcccttttt 33922855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 13 - 93
Target Start/End: Original strand, 14553543 - 14553626
Alignment:
Q  13 tcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagct 93  Q
    |||||||||||| ||||||||||| || ||| |||||||||||  |||||||||||||||   ||||||| | |||||||||||    
T  14553543 tcttgtgtaaaaaatagggtaaggctgtgtataatacaccaaaactggtgggaccccttcgtagaccctgtgtatgcgggagct 14553626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 117
Target Start/End: Original strand, 20400688 - 20400804
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  ||||||||  |||||||| ||||| |||| | ||||||| || ||| ||||| || |||| | | |||||||||    
T  20400688 tggaaacaatctcttgtgtaaaaaacagggtaagactgcgtacagtacactaaatagcgggacccttttccgaaccctacgtatgcagaaactttagtgc 20400787  T
Q  101 accgggttgcccttttt 117  Q
    ||||  ||| |||||||    
T  20400788 accgaattgtccttttt 20400804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 46 - 118
Target Start/End: Original strand, 34850602 - 34850674
Alignment:
Q  46 tacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||| |||||||||| ||||||||||| | |||||| ||   |||||||||||||| ||||||| ||||||||    
T  34850602 tacatcaaatggtggaaccccttcccgaatcctgcgtatataggagctttagtgcatcgggttgtcctttttt 34850674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 21 - 114
Target Start/End: Complemental strand, 2755518 - 2755422
Alignment:
Q  21 aaaaatagggtaagggtgcgtacaatacacc--aaatggtgggaccccttcccggaccctgcggat--gcgggagctttagtgcaccgggttgccctt 114  Q
    ||||||||| ||||| |||||||||||||||  |||||||||||  |||||||  | |||||  ||  ||||||||||||||||||| ||||||||||    
T  2755518 aaaaataggctaaggctgcgtacaatacaccaaaaatggtgggagtccttcccaaatcctgcatatgcgcgggagctttagtgcacc-ggttgccctt 2755422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 115
Target Start/End: Complemental strand, 13628334 - 13628256
Alignment:
Q  37 tgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    |||||||||||||| |||| |   ||||||||||  ||| ||||| ||||||||| |||||||||| || |||||||||    
T  13628334 tgcgtacaatacactaaatagcaagaccccttcctagactctgcgtatgcgggagttttagtgcactggattgcccttt 13628256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 83 - 117
Target Start/End: Original strand, 25997752 - 25997786
Alignment:
Q  83 atgcgggagctttagtgcaccgggttgcccttttt 117  Q
    ||||||||||| |||||||||||||||||||||||    
T  25997752 atgcgggagctctagtgcaccgggttgcccttttt 25997786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 4 - 77
Target Start/End: Original strand, 6024256 - 6024332
Alignment:
Q  4 gaaacaacctcttgtgt-aaaaatagggtaagggtgcgtacaatacacca--aatggtgggaccccttcccggaccc 77  Q
    |||||| |||||||||| ||||| | ||||||  ||||||||||||||||  |||| ||||||| ||||||||||||    
T  6024256 gaaacagcctcttgtgtaaaaaacatggtaagactgcgtacaatacaccaataatgatgggacctcttcccggaccc 6024332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 60 - 96
Target Start/End: Complemental strand, 29016337 - 29016301
Alignment:
Q  60 ggaccccttcccggaccctgcggatgcgggagcttta 96  Q
    |||||||||||| ||||||||| ||||||||||||||    
T  29016337 ggaccccttcccagaccctgcgtatgcgggagcttta 29016301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 2 - 116
Target Start/End: Complemental strand, 48746 - 48633
Alignment:
Q  2 tggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgca 101  Q
    |||||||| ||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| |||||||    
T  48746 tggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgca 48648  T
Q  102 ccgggttgccctttt 116  Q
    |||||||||||||||    
T  48647 ccgggttgccctttt 48633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0258 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: scaffold0258
Description:

Target: scaffold0258; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 13138 - 13022
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||| ||||||| | ||||||| ||||||||||||||| ||||||||||||||||||| ||||||||| ||||||| ||||||||||    
T  13138 ctggaaacagcctcttgcgtaaaaacaaggtaaggctgcgtacaatacaccgaatggtgggaccccttcccagaccctgcgtatgcgggggctttagtgc 13039  T
Q  101 accgggttgcccttttt 117  Q
    |||||||||||||||||    
T  13038 accgggttgcccttttt 13022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0168 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: scaffold0168
Description:

Target: scaffold0168; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 30599 - 30714
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  |||||| || ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| ||||||    
T  30599 ctggaaacagcctcttgtgtaaaac-agggtagggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgc 30697  T
Q  101 accgggttgcccttttt 117  Q
    |||||||||||||||||    
T  30698 accgggttgcccttttt 30714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0311 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: scaffold0311
Description:

Target: scaffold0311; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 5 - 116
Target Start/End: Original strand, 10834 - 10946
Alignment:
Q  5 aaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcacc 103  Q
    |||||||||||||||||||||  |||||| || ||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||     
T  10834 aaacaacctcttgtgtaaaaaacagggtagggctgcgtccaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcact 10933  T
Q  104 gggttgccctttt 116  Q
    ||||||| |||||    
T  10934 gggttgctctttt 10946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0180 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: scaffold0180
Description:

Target: scaffold0180; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 28 - 118
Target Start/End: Complemental strand, 24220 - 24130
Alignment:
Q  28 gggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| ||||||||||| ||||||||||||    
T  24220 gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgccctttttt 24130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1176 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: scaffold1176
Description:

Target: scaffold1176; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 5 - 111
Target Start/End: Complemental strand, 1696 - 1591
Alignment:
Q  5 aaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccg 104  Q
    ||||||||||||||||||||  ||| ||||| ||| |||||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||||||     
T  1696 aaacaacctcttgtgtaaaac-aggataaggctgcatacaatacaccaaatgatgggaccccttcccggacccggcgtatgcgggagctttagtgcacca 1598  T
Q  105 ggttgcc 111  Q
    |||||||    
T  1597 ggttgcc 1591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0223 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 11151 - 11264
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  | | ||||| ||| ||||||||||||||||||||||| ||||||||||||||||  ||||||||||| ||||||    
T  11151 ctggaaacagcctcttgtgtaaaacaaag-taaggctgcttacaatacaccaaatggtgggacaccttcccggaccctgcatatgcgggagctctagtgc 11249  T
Q  101 accgggttgcccttt 115  Q
    ||| |||||||||||    
T  11250 accaggttgcccttt 11264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0049 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: scaffold0049
Description:

Target: scaffold0049; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 58997 - 59114
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcggatgcgggagctttag 97  Q
    ||||||||| |||||||| ||||||  ||||||||  ||||||||||||||||||  ||||||||||||||||| ||| ||||| |||||||||||||||    
T  58997 ctggaaacagcctcttgtataaaaaacagggtaagactgcgtacaatacaccaaaaatggtgggaccccttcccagactctgcgtatgcgggagctttag 59096  T
Q  98 tgcaccgggttgcccttt 115  Q
    |||| |||||||||||||    
T  59097 tgcatcgggttgcccttt 59114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: scaffold0187
Description:

Target: scaffold0187; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 10163 - 10052
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  || |||||  ||||||||||||||||||| ||||||||||||||||||||||||  |||| ||||||  |||||    
T  10163 ctggaaacagcctcttgtgtaaaac-agagtaagactgcgtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgc 10065  T
Q  101 accgggttgccct 113  Q
    |||||||||||||    
T  10064 accgggttgccct 10052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 20491 - 20380
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgc 100  Q
    ||||||||| ||||||||||||||  || |||||  ||||||||||||||||||| ||||||||||||||||||||||||  |||| ||||||  |||||    
T  20491 ctggaaacagcctcttgtgtaaaac-agagtaagactgcgtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgc 20393  T
Q  101 accgggttgccct 113  Q
    |||||||||||||    
T  20392 accgggttgccct 20380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 12 - 115
Target Start/End: Complemental strand, 72971 - 72867
Alignment:
Q  12 ctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgc 110  Q
    ||||||||||||||  | ||||||| ||| |||||||||||||||||| | ||||||||||||| |||||| ||||||||||||||||||||| ||||||    
T  72971 ctcttgtgtaaaaaacacggtaaggctgcctacaatacaccaaatggtagtaccccttcccggaacctgcgtatgcgggagctttagtgcaccaggttgc 72872  T
Q  111 ccttt 115  Q
    |||||    
T  72871 ccttt 72867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0954 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0954
Description:

Target: scaffold0954; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 3564 - 3679
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtg 99  Q
    ||||||| | |||||||||||||| ||| ||||||| |||||| |||||||| |||| ||||||||||||||| |||||||| |||||| ||||||||||    
T  3564 ctggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagctttagtg 3663  T
Q  100 caccgggttgcccttt 115  Q
    ||||| ||| ||||||    
T  3664 caccgagtttcccttt 3679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0254 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0254
Description:

Target: scaffold0254; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 4177 - 4258
Alignment:
Q  1 ctggaaacaacctcttgtgtaaaa-atagggtaagggtgcgtacaatacacc---aaatggtgggaccccttcccggaccct 78  Q
    |||||||||||||||||||||||| | ||| ||||| |||||||||||||||   || ||||||||||||||||||||||||    
T  4177 ctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataattggtgggaccccttcccggaccct 4258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0167 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0167
Description:

Target: scaffold0167; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 5 - 95
Target Start/End: Original strand, 23623 - 23714
Alignment:
Q  5 aaacaacctcttgtgtaaaaat-agggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagcttt 95  Q
    |||||||||||||||||||||  ||||| ||| ||||||||||  | ||||||||||||||||||||| |||| || | ||| |||||||||    
T  23623 aaacaacctcttgtgtaaaaaacagggtgaggctgcgtacaatgtagcaaatggtgggaccccttcccagaccttgagtatgtgggagcttt 23714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0194 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0194
Description:

Target: scaffold0194; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 28 - 118
Target Start/End: Original strand, 24696 - 24786
Alignment:
Q  28 gggtaagggtgcgtacaatacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgccctttttt 118  Q
    |||||||  |||||| |||||||||||| ||||  |||||| || ||||||||| || ||||||||| |||||||| | ||||||||||||    
T  24696 gggtaagactgcgtataatacaccaaatagtggaccccctttccagaccctgcgtatacgggagcttcagtgcacctgattgccctttttt 24786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 16 - 70
Target Start/End: Complemental strand, 35116 - 35062
Alignment:
Q  16 tgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccccttcc 70  Q
    ||||| |||| ||||||||| ||||||||||||||||||||||||||||| ||||    
T  35116 tgtgtgaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccctttcc 35062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0867 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0867
Description:

Target: scaffold0867; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 5 - 65
Target Start/End: Complemental strand, 3778 - 3719
Alignment:
Q  5 aaacaacctcttgtgtaaaaatagggtaagggtgcgtacaatacaccaaatggtgggaccc 65  Q
    |||||||| |||||||||| | | ||||| | |||||||||||||||||||||||||||||    
T  3778 aaacaacc-cttgtgtaaatacaaggtaacgttgcgtacaatacaccaaatggtgggaccc 3719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 115
Target Start/End: Complemental strand, 58699 - 58630
Alignment:
Q  45 atacaccaaatggtgggaccccttcccggaccctgcggatgcgggagctttagtgcaccgggttgcccttt 115  Q
    ||||||| ||||||| ||||||||| ||||||||| | ||||||||||| | ||||||| || ||||||||    
T  58699 atacaccgaatggtgagaccccttctcggaccctgtgtatgcgggagctct-gtgcaccaggctgcccttt 58630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University