View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19757_low_91 (Length: 277)
Name: NF19757_low_91
Description: NF19757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19757_low_91 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 14 - 277
Target Start/End: Original strand, 14518066 - 14518325
Alignment:
| Q |
14 |
tactttttcaggtaaaaatggaatgtacactatgaaatactaataagaacatcggacacgatatttataccgacacatttgcatcaggaataatttgaga |
113 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14518066 |
tactttttcaggtataaatggaatgtacactatgaaatactaataagaacatcggacacgatatttataccgacacatttgcatcatgaataatttgaga |
14518165 |
T |
 |
| Q |
114 |
aaatagatgtaattgaacgaaaccacacatgtcaatgtcgtctcagtgtcggatacaagacacttctttaatccgaattgccgatgctagatagatagtc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14518166 |
aaatagatgtaattgaacgaaaccacacgtgtcaatgtcgtctcagtgtcggatacaagacacttctttaatccgaattgccgatgctagatagatagtc |
14518265 |
T |
 |
| Q |
214 |
atataaaataaattaatttaatgcatgtcttaccagttccaatattagagtgttgaatttctac |
277 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14518266 |
atataaaataaattaattta----atgtcttaccagttccaatattagagtgttgaatttctac |
14518325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University