View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19758_low_4 (Length: 260)
Name: NF19758_low_4
Description: NF19758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19758_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 39591215 - 39591464
Alignment:
| Q |
1 |
cacaaacctaatcagttaccctcctactaacagcctattttagcttcttggggaaatatttcacatataacttctatcatagaagttctatggatcagaa |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39591215 |
cacaaacctaatcagttacactcctactaacagcctattttagcttcttggggaaatatttcacatataacttctatcatagaagttctatggatcagaa |
39591314 |
T |
|
| Q |
101 |
atgcttcctagacctgtagtggcaagtttactgacaagagctagagcgttactggttatataataggctttgagaaccctattttgcagcaattgaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39591315 |
atgcttcctagacctgtagtggcaagtttactgacaagagctagagcgttactggttatataataggctttgagaaccctattttgcagcaattgaattt |
39591414 |
T |
|
| Q |
201 |
tcctaccgttttcgccttgaaacccatcaaggcaagtatcttgatctgtg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39591415 |
tcctaccgttttcgccttgaaacccatcaaggcaagtatcttgatctgtg |
39591464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University