View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19759_high_11 (Length: 239)
Name: NF19759_high_11
Description: NF19759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19759_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 121 - 220
Target Start/End: Original strand, 11354121 - 11354220
Alignment:
| Q |
121 |
ttcatgtgcgcgctcgaaatcattctcacagggaagcaattaactaatgtatgccaaatgcaatgttgatgcgaaaattaatactaattgttagagggtt |
220 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || ||||||||||| ||||| |||||||| |
|
|
| T |
11354121 |
ttcatgtgcacgctcgaaatcattctcacagggaagcaattaactaatgtatgccaaatgcaatgctgacgcaaaaattaataccgattgtcagagggtt |
11354220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University