View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19759_high_6 (Length: 445)
Name: NF19759_high_6
Description: NF19759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19759_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 15 - 380
Target Start/End: Complemental strand, 12811961 - 12811596
Alignment:
| Q |
15 |
cccttatcattttctctagccgtggcaaactctatgaatttggaagtgttgggtaannnnnnnatagatctatttattaattgtttgaaagtttcaattt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12811961 |
cccttatcattttctctagccgtggcaaactctatgaatttggaagtgttgggtaatttttttatagatctatttattaattgtttgaaagtttcaattt |
12811862 |
T |
|
| Q |
115 |
tattgtctatttttgtgaggtccaaatcccaatggttaatagaatcatttattttctttcttatagttttgtattttgggttttgtgatgatgtgaactg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12811861 |
tattgtctatttttgtgaggtccaaatcccaatggttaatagaatcatttattttctttcttatagttttgtattttgggttttgtgatgatgtgaactg |
12811762 |
T |
|
| Q |
215 |
agatattgtgatgcataacttcttctttcctttcttctttgcatcagtttctttcacgaaaatggttactggttttctgcttcnnnnnnncctcttaaat |
314 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12811761 |
agatattgtgatgtataacttcttctttcctttcttctttgcatcagtttctttcaccaaaatggttactggttttctgcttctttttttcctcttaaat |
12811662 |
T |
|
| Q |
315 |
tgccacaactgaatttgatgcttttaagatttatctacacataagtacttttgacacattaagtag |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12811661 |
tgccacaactgaatttgatgcttttaagatttatctacacataagtacttttgacacattaagtag |
12811596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 28470549 - 28470594
Alignment:
| Q |
244 |
ctttcttctttgcatcagtttctttcacgaaaatggttactggttt |
289 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
28470549 |
ctttcttcattgcatcagtttctttcaccaaaatggtcactggttt |
28470594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University