View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19759_low_18 (Length: 216)
Name: NF19759_low_18
Description: NF19759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19759_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 9 - 211
Target Start/End: Complemental strand, 39145649 - 39145441
Alignment:
| Q |
9 |
agcagagaaagtgtggtgtatcattccaaaatgattcattagagccatttgtacgaaggaaaagagaaggagtatatggccgcacacgtatccaatgtcg |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39145649 |
agcagggaaagtgtggtgtatcattccaaaatgattcattagagccatttgaacgaaggaaaagagaaggagtatatggccgcacacgtatccaatgtcg |
39145550 |
T |
 |
| Q |
109 |
gagaccacgagcatatggagg------cggaaaacggagagatgttgtgggagggttgatgcgtaggagaagatgaagcagccaaatgccatgaacacgg |
202 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
39145549 |
gagaccacgagcatatggaggcggaggcggaaaacggagagatgttgtgggagggctgatgcgtaggaaaagatgaagcagccaaatgccatgaacgcgg |
39145450 |
T |
 |
| Q |
203 |
agagattaa |
211 |
Q |
| |
|
||||||||| |
|
|
| T |
39145449 |
agagattaa |
39145441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University